Transcript: Human NM_015884.4

Homo sapiens membrane bound transcription factor peptidase, site 2 (MBTPS2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
MBTPS2 (51360)
Length:
4446
CDS:
119..1678

Additional Resources:

NCBI RefSeq record:
NM_015884.4
NBCI Gene record:
MBTPS2 (51360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015884.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432967 GATGGTTACAGCACGGTAATG pLKO_005 1660 CDS 100% 10.800 15.120 N Mbtps2 n/a
2 TRCN0000016563 CCCGTCAATCAACTGACCTAT pLKO.1 575 CDS 100% 4.950 6.930 N MBTPS2 n/a
3 TRCN0000016566 GCGGAAAGCAAGGATGCTTTA pLKO.1 316 CDS 100% 1.080 1.512 N MBTPS2 n/a
4 TRCN0000343048 GCGGAAAGCAAGGATGCTTTA pLKO_005 316 CDS 100% 1.080 1.512 N MBTPS2 n/a
5 TRCN0000016564 CCAGTAATTCTCTTGCCATTT pLKO.1 845 CDS 100% 10.800 7.560 N MBTPS2 n/a
6 TRCN0000280402 CCAGTAATTCTCTTGCCATTT pLKO_005 845 CDS 100% 10.800 7.560 N MBTPS2 n/a
7 TRCN0000221460 GCAGCTATTAGGGAACAAGTT pLKO.1 650 CDS 100% 4.950 3.465 N Mbtps2 n/a
8 TRCN0000016565 GCATCAACTTTACAGCAGTTA pLKO.1 1052 CDS 100% 4.950 3.465 N MBTPS2 n/a
9 TRCN0000280447 GCATCAACTTTACAGCAGTTA pLKO_005 1052 CDS 100% 4.950 3.465 N MBTPS2 n/a
10 TRCN0000016567 GCTCAAGTTCAAGTTTCTGTA pLKO.1 1257 CDS 100% 4.950 3.465 N MBTPS2 n/a
11 TRCN0000297294 GCTCAAGTTCAAGTTTCTGTA pLKO_005 1257 CDS 100% 4.950 3.465 N MBTPS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015884.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11981 pDONR223 100% 63.1% 61.8% None (many diffs) n/a
2 ccsbBroad304_11981 pLX_304 0% 63.1% 61.8% V5 (many diffs) n/a
3 TRCN0000468450 AGGCGAGCTCAATTTCCCCGCCAT pLX_317 24.2% 63.1% 61.8% V5 (many diffs) n/a
Download CSV