Transcript: Human NM_015886.5

Homo sapiens peptidase inhibitor 15 (PI15), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
PI15 (51050)
Length:
6735
CDS:
183..959

Additional Resources:

NCBI RefSeq record:
NM_015886.5
NBCI Gene record:
PI15 (51050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015886.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166088 GCACTGGAAGATATCGCTCTA pLKO.1 565 CDS 100% 4.050 5.670 N PI15 n/a
2 TRCN0000166127 CCACTTCCAATCGGATAGGAT pLKO.1 718 CDS 100% 3.000 4.200 N PI15 n/a
3 TRCN0000161559 GCACAATTAGATTCAGCGGAT pLKO.1 318 CDS 100% 2.160 3.024 N PI15 n/a
4 TRCN0000160377 CTTGTACTGACAATCTGTGTT pLKO.1 898 CDS 100% 4.950 3.960 N PI15 n/a
5 TRCN0000161313 GCGCAATTCATACTTGCCAAA pLKO.1 739 CDS 100% 4.050 3.240 N PI15 n/a
6 TRCN0000166695 CGACGTGCAGTTTACTTGGTA pLKO.1 786 CDS 100% 3.000 2.400 N PI15 n/a
7 TRCN0000160723 CCAGATGTCCTATGAGATGTT pLKO.1 658 CDS 100% 4.950 3.465 N PI15 n/a
8 TRCN0000162056 GTTCATCTTGTCCTCCAAGTT pLKO.1 868 CDS 100% 4.950 3.465 N PI15 n/a
9 TRCN0000159251 GCTCTGAAAGCACAATTAGAT pLKO.1 309 CDS 100% 5.625 3.375 N PI15 n/a
10 TRCN0000165911 GCAGAATGACATGATCGCCAT pLKO.1 371 CDS 100% 2.160 1.296 N PI15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015886.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03185 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03185 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469429 CGTTCTTTAAATAGAGTGTCTACG pLX_317 59.5% 100% 100% V5 n/a
Download CSV