Transcript: Human NM_015938.4

Homo sapiens NMD3 ribosome export adaptor (NMD3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
NMD3 (51068)
Length:
2779
CDS:
141..1652

Additional Resources:

NCBI RefSeq record:
NM_015938.4
NBCI Gene record:
NMD3 (51068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120947 GCCAACTGTAACTTAAATGAT pLKO.1 1281 CDS 100% 5.625 7.875 N Nmd3 n/a
2 TRCN0000320140 GCCAACTGTAACTTAAATGAT pLKO_005 1281 CDS 100% 5.625 7.875 N Nmd3 n/a
3 TRCN0000148314 CGTACTCATTTGGGACATCTT pLKO.1 1224 CDS 100% 4.950 6.930 N NMD3 n/a
4 TRCN0000343553 CGTACTCATTTGGGACATCTT pLKO_005 1224 CDS 100% 4.950 6.930 N NMD3 n/a
5 TRCN0000147317 GCTATCCTTCAACAAGTGTTT pLKO.1 510 CDS 100% 4.950 6.930 N NMD3 n/a
6 TRCN0000352875 GCTATCCTTCAACAAGTGTTT pLKO_005 510 CDS 100% 4.950 6.930 N NMD3 n/a
7 TRCN0000147407 GATGCTTGAAGACCTTCATAT pLKO.1 1586 CDS 100% 13.200 9.240 N NMD3 n/a
8 TRCN0000343501 GATGCTTGAAGACCTTCATAT pLKO_005 1586 CDS 100% 13.200 9.240 N NMD3 n/a
9 TRCN0000120949 GTTCCAATATGCAAGGATAAT pLKO.1 879 CDS 100% 13.200 9.240 N Nmd3 n/a
10 TRCN0000320202 GTTCCAATATGCAAGGATAAT pLKO_005 879 CDS 100% 13.200 9.240 N Nmd3 n/a
11 TRCN0000148397 CTACTATCTTTGCCTCCAGAT pLKO.1 1718 3UTR 100% 4.050 2.835 N NMD3 n/a
12 TRCN0000343554 CTACTATCTTTGCCTCCAGAT pLKO_005 1718 3UTR 100% 4.050 2.835 N NMD3 n/a
13 TRCN0000146393 CCAGCATGAAGATAATGGCTA pLKO.1 2504 3UTR 100% 2.640 1.848 N NMD3 n/a
14 TRCN0000147350 GATACAGATGATGAAAGGCAA pLKO.1 1434 CDS 100% 2.640 1.848 N NMD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03189 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03189 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471096 TTGGAGCTGGACAACCTCATTCTG pLX_317 30.6% 100% 100% V5 n/a
Download CSV