Transcript: Human NM_015965.7

Homo sapiens NADH:ubiquinone oxidoreductase subunit A13 (NDUFA13), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NDUFA13 (51079)
Length:
521
CDS:
15..449

Additional Resources:

NCBI RefSeq record:
NM_015965.7
NBCI Gene record:
NDUFA13 (51079)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015965.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244239 ATGGGCCCATCGACTACAAAC pLKO_005 61 CDS 100% 10.800 15.120 N NDUFA13 n/a
2 TRCN0000064929 CATCGACTACAAACGGAACTT pLKO.1 68 CDS 100% 4.950 6.930 N NDUFA13 n/a
3 TRCN0000064932 CATAGGGATTGGAACCCTGAT pLKO.1 125 CDS 100% 4.050 5.670 N NDUFA13 n/a
4 TRCN0000064928 GCGCCTACAAATCGAGGACTT pLKO.1 188 CDS 100% 4.050 5.670 N NDUFA13 n/a
5 TRCN0000236379 CTACGGGCACTGGAGCATAAT pLKO_005 146 CDS 100% 13.200 10.560 N NDUFA13 n/a
6 TRCN0000236380 AGCATGCTGGCCATAGGGATT pLKO_005 114 CDS 100% 4.050 2.835 N NDUFA13 n/a
7 TRCN0000064931 CTGGAGCATAATGAAGTGGAA pLKO.1 155 CDS 100% 2.640 1.848 N NDUFA13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015965.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03197 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03197 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479838 TGGTCAGGATTAAAAAAGACTATT pLX_317 90.9% 100% 100% V5 n/a
Download CSV