Transcript: Human NM_015986.4

Homo sapiens cytokine receptor like factor 3 (CRLF3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
CRLF3 (51379)
Length:
2873
CDS:
42..1370

Additional Resources:

NCBI RefSeq record:
NM_015986.4
NBCI Gene record:
CRLF3 (51379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015986.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322834 CTCCAGAGCTCCGACTTATTT pLKO_005 956 CDS 100% 15.000 10.500 N CRLF3 n/a
2 TRCN0000370377 AGTCTGAGCAGTCGAAGAAAT pLKO_005 894 CDS 100% 13.200 9.240 N CRLF3 n/a
3 TRCN0000063380 CCATTGAACAGGAGACCATTA pLKO.1 289 CDS 100% 10.800 7.560 N CRLF3 n/a
4 TRCN0000300986 CCATTGAACAGGAGACCATTA pLKO_005 289 CDS 100% 10.800 7.560 N CRLF3 n/a
5 TRCN0000063378 CCAGTACAGATAGAAGAACTA pLKO.1 585 CDS 100% 4.950 3.465 N CRLF3 n/a
6 TRCN0000300919 CCAGTACAGATAGAAGAACTA pLKO_005 585 CDS 100% 4.950 3.465 N CRLF3 n/a
7 TRCN0000063382 GCACTTCGGAACGATTCTGAA pLKO.1 918 CDS 100% 4.950 3.465 N CRLF3 n/a
8 TRCN0000300918 GCACTTCGGAACGATTCTGAA pLKO_005 918 CDS 100% 4.950 3.465 N CRLF3 n/a
9 TRCN0000063379 CCCAGATAGGTCATTCCACAT pLKO.1 835 CDS 100% 4.050 2.835 N CRLF3 n/a
10 TRCN0000063381 GCTGTGTGCATTAGTACAAAT pLKO.1 1092 CDS 100% 13.200 7.920 N CRLF3 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2107 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000126165 CCACTAGATGACTGCCAGAAA pLKO.1 312 CDS 100% 4.950 3.465 N Crlf3 n/a
13 TRCN0000308427 CCACTAGATGACTGCCAGAAA pLKO_005 312 CDS 100% 4.950 3.465 N Crlf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015986.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.