Transcript: Human NM_016019.5

Homo sapiens LUC7 like 2, pre-mRNA splicing factor (LUC7L2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LUC7L2 (51631)
Length:
2661
CDS:
369..1547

Additional Resources:

NCBI RefSeq record:
NM_016019.5
NBCI Gene record:
LUC7L2 (51631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016019.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314557 CCTACGGAGTTACGTACTATT pLKO_005 1581 3UTR 100% 13.200 6.600 Y LUC7L2 n/a
2 TRCN0000195117 CTCTATTCTGTTACGTCATTA pLKO.1 2427 3UTR 100% 13.200 6.600 Y LUC7L2 n/a
3 TRCN0000099566 GCACCTGGGATTTATTGAAAT pLKO.1 1010 CDS 100% 13.200 6.600 Y Luc7l2 n/a
4 TRCN0000309132 GCACCTGGGATTTATTGAAAT pLKO_005 1010 CDS 100% 13.200 6.600 Y Luc7l2 n/a
5 TRCN0000001190 GCTGTGGGCATTTCCTCTATT pLKO.1 2413 3UTR 100% 13.200 6.600 Y LUC7L2 n/a
6 TRCN0000001191 CGGTCCTATGAGAGTGCTAAT pLKO.1 1473 CDS 100% 10.800 5.400 Y LUC7L2 n/a
7 TRCN0000314556 CGGTCCTATGAGAGTGCTAAT pLKO_005 1473 CDS 100% 10.800 5.400 Y LUC7L2 n/a
8 TRCN0000001194 GAACGGCTGAAACGAAGAGAA pLKO.1 1092 CDS 100% 4.950 2.475 Y LUC7L2 n/a
9 TRCN0000320723 GAACGGCTGAAACGAAGAGAA pLKO_005 1092 CDS 100% 4.950 2.475 Y LUC7L2 n/a
10 TRCN0000001193 GTAATGGATGAAGTAGAGAAA pLKO.1 831 CDS 100% 4.950 2.475 Y LUC7L2 n/a
11 TRCN0000320721 GTAATGGATGAAGTAGAGAAA pLKO_005 831 CDS 100% 4.950 2.475 Y LUC7L2 n/a
12 TRCN0000001192 GCAGAGGAAGTTTATCGGAAT pLKO.1 873 CDS 100% 4.050 2.025 Y LUC7L2 n/a
13 TRCN0000320722 GCAGAGGAAGTTTATCGGAAT pLKO_005 873 CDS 100% 4.050 2.025 Y LUC7L2 n/a
14 TRCN0000196311 GAAGAATTAAAGAGAGTCGTA pLKO.1 1044 CDS 100% 2.640 1.320 Y LUC7L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016019.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03349 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03349 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472615 TCCGGGGCCGATTCGTTAGCTGAC pLX_317 45.2% 100% 100% V5 n/a
Download CSV