Construct: ORF TRCN0000472615
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015799.1_s317c1
- Derived from:
- ccsbBroadEn_03349
- DNA Barcode:
- TCCGGGGCCGATTCGTTAGCTGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LUC7L2 (51631)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472615
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51631 | LUC7L2 | LUC7 like 2, pre-mRNA splic... | NM_016019.5 | 100% | 100% | |
2 | human | 51631 | LUC7L2 | LUC7 like 2, pre-mRNA splic... | NM_001270643.1 | 94.6% | 94.7% | (many diffs) |
3 | human | 51631 | LUC7L2 | LUC7 like 2, pre-mRNA splic... | NM_001244585.1 | 93.3% | 95.6% | (many diffs) |
4 | human | 100996928 | FMC1-LUC7L2 | FMC1-LUC7L2 readthrough | NM_001244584.2 | 83.9% | 81.1% | (many diffs) |
5 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_138680.3 | 93.7% | 99.4% | (many diffs) |
6 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_001170848.2 | 91.3% | 96.9% | (many diffs) |
7 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_006505749.3 | 90.7% | 93.9% | (many diffs) |
8 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_006505750.3 | 90.7% | 93.9% | (many diffs) |
9 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255225.1 | 90.7% | 93.9% | (many diffs) |
10 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255226.1 | 90.7% | 93.9% | (many diffs) |
11 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255227.1 | 90.7% | 93.9% | (many diffs) |
12 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_001331222.1 | 88.4% | 91.4% | (many diffs) |
13 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255228.1 | 88.4% | 91.4% | (many diffs) |
14 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_006505747.4 | 88.2% | 91.4% | (many diffs) |
15 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_006505748.4 | 85.9% | 88.9% | (many diffs) |
16 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_001311099.2 | 81% | 85.9% | (many diffs) |
17 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_006505754.4 | 81% | 85.9% | (many diffs) |
18 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_017321458.1 | 81% | 85.9% | (many diffs) |
19 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255229.1 | 81% | 85.9% | (many diffs) |
20 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255230.1 | 81% | 85.9% | (many diffs) |
21 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255231.1 | 81% | 85.9% | (many diffs) |
22 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255232.1 | 81% | 85.9% | (many diffs) |
23 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_001331223.1 | 78.6% | 83.4% | (many diffs) |
24 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255233.1 | 78.6% | 83.4% | (many diffs) |
25 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255234.1 | 78.6% | 83.4% | (many diffs) |
26 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255235.1 | 78.6% | 83.4% | (many diffs) |
27 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_001170849.2 | 77% | 82.3% | (many diffs) |
28 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255236.1 | 74.2% | 77.1% | (many diffs) |
29 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | XM_030255237.1 | 74.2% | 77.1% | (many diffs) |
30 | mouse | 192196 | Luc7l2 | LUC7-like 2 (S. cerevisiae) | NM_001311100.2 | 64.3% | 68.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggcgcaggcc cagatgcgcg cgatgctgga ccagttgatg ggcacctccc 121 gggacggaga tacaactcgt caacgaatca aattcagtga tgacagagta tgcaagagtc 181 accttctcaa ctgttgtcct catgatgtcc tttctggaac tagaatggat cttggagaat 241 gtctgaaagt ccatgacctg gctttaagag cggattatga aattgcatcc aaagaacaag 301 attttttctt tgaacttgat gccatggatc atctgcagtc attcattgca gattgtgatc 361 gtagaacaga agtggccaag aaaagattag cagaaactca agaagagatt agtgctgaag 421 tagcagcaaa ggcagaacgt gttcatgagt taaatgaaga aattggtaaa ttgttagcca 481 aggtggaaca actaggagct gaagggaatg tggaggaatc ccagaaagta atggatgaag 541 tagagaaagc acgggcaaag aaaagagaag cagaggaagt ttatcggaat tctatgccag 601 cttccagttt tcagcagcag aaacttcgag tctgtgaagt ctgctctgcc tatttaggac 661 ttcatgataa tgacagacga ctggctgatc attttggggg taaactgcac cTGGGATTTA 721 TTGAAATAAG AGAGAAGCTT GAAGAATTAA AGAGAGTCGT AGCTGAGAAG CAGGAGAAAA 781 GAAACCAGGA ACGGCTGAAA CGAAGAGAAG AGAGAGAGAG AGAAGAAAGG GAGAAGCTGA 841 GGAGGTCCCG ATCACACAGC AAGAATCCAA AAAGATCCAG GTCCAGAGAG CATCGCAGAC 901 ATCGATCTCG CTCCATGTCA CGTGAACGCA AGAGGAGAAC TCGATCCAAA TCTCGGGAGA 961 AACGCCATCG CCACAGGTCC CGCTCCAGCA GCCGTAGCCG CAGCCGTAGC CACCAGAGAA 1021 GTCGGCACAG TTCTAGAGAT AGGAGCAGAG AACGATCCAA GAGGAGATCC TCAAAAGAAA 1081 GATTCAGAGA CCAAGACTTA GCATCATGTG ACAGAGACAG GAGTTCAAGA GACAGATCAC 1141 CTCGTGACAG AGATCGGAAA GATAAGAAGC GGTCCTATGA GAGTGCTAAT GGCAGATCAG 1201 AAGACAGGAG GAGCTCTGAA GAGCGCGAAG CAGGGGAGAT CTACCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGATCC GGGGCCGATT CGTTAGCTGA CACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t