Transcript: Human NM_016027.3

Homo sapiens lactamase beta 2 (LACTB2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LACTB2 (51110)
Length:
1526
CDS:
66..932

Additional Resources:

NCBI RefSeq record:
NM_016027.3
NBCI Gene record:
LACTB2 (51110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167705 GCTGATATTATATATCCAGGA pLKO.1 639 CDS 100% 2.160 3.024 N LACTB2 n/a
2 TRCN0000229430 GACACTACCTATTGCATTAAA pLKO_005 351 CDS 100% 15.000 12.000 N LACTB2 n/a
3 TRCN0000218455 TTTGGCCGTTAGTTATCTATT pLKO_005 1248 3UTR 100% 13.200 10.560 N LACTB2 n/a
4 TRCN0000167790 GCCGTTAGTTATCTATTACTA pLKO.1 1252 3UTR 100% 5.625 4.500 N LACTB2 n/a
5 TRCN0000229431 CCACTCTAAGAGTTCTATATA pLKO_005 469 CDS 100% 15.000 10.500 N LACTB2 n/a
6 TRCN0000229433 GCAGCAAATTCTTACATTATT pLKO_005 728 CDS 100% 15.000 10.500 N LACTB2 n/a
7 TRCN0000229432 GGGAAGGAACAACGGTATTTG pLKO_005 568 CDS 100% 13.200 9.240 N LACTB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016027.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03211 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03211 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468668 AGACCAGCGTATAACAAGCTCTTT pLX_317 26% 100% 100% V5 n/a
Download CSV