Transcript: Human NM_016053.4

Homo sapiens WASH complex subunit 3 (WASHC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
WASHC3 (51019)
Length:
882
CDS:
30..614

Additional Resources:

NCBI RefSeq record:
NM_016053.4
NBCI Gene record:
WASHC3 (51019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134437 GAAGAAAGTTCAGATAGCGAA pLKO.1 576 CDS 100% 2.640 3.696 N WASHC3 n/a
2 TRCN0000330169 GTGTACCAGTGATGGCAATAA pLKO_005 466 CDS 100% 13.200 9.240 N WASHC3 n/a
3 TRCN0000134348 GACTACAGGAAAGTGAAGTAT pLKO.1 376 CDS 100% 5.625 3.938 N WASHC3 n/a
4 TRCN0000330097 GACTACAGGAAAGTGAAGTAT pLKO_005 376 CDS 100% 5.625 3.938 N WASHC3 n/a
5 TRCN0000133819 CTAGATGATGTCACAGTTGAA pLKO.1 264 CDS 100% 4.950 3.465 N WASHC3 n/a
6 TRCN0000134605 GATGATGTCACAGTTGAAGTA pLKO.1 267 CDS 100% 4.950 3.465 N WASHC3 n/a
7 TRCN0000330167 GATGATGTCACAGTTGAAGTA pLKO_005 267 CDS 100% 4.950 3.465 N WASHC3 n/a
8 TRCN0000330098 GATCCAAGATATGCCAGATAT pLKO_005 426 CDS 100% 13.200 7.920 N WASHC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08195 pDONR223 100% 99.8% 99.4% None 329A>G n/a
2 ccsbBroad304_08195 pLX_304 0% 99.8% 99.4% V5 329A>G n/a
3 TRCN0000473745 GAATACGAATTTGGGGTATACTTA pLX_317 93.5% 99.8% 99.4% V5 329A>G n/a
Download CSV