Transcript: Human NM_016063.3

Homo sapiens HD domain containing 2 (HDDC2), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
HDDC2 (51020)
Length:
1446
CDS:
36..650

Additional Resources:

NCBI RefSeq record:
NM_016063.3
NBCI Gene record:
HDDC2 (51020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252207 CATGTACCGGATGGCAGTTAT pLKO_005 182 CDS 100% 13.200 18.480 N Hddc2 n/a
2 TRCN0000138893 GAGACCCAATCTAGTGCAGAA pLKO.1 420 CDS 100% 4.050 5.670 N HDDC2 n/a
3 TRCN0000292181 GAGACCCAATCTAGTGCAGAA pLKO_005 420 CDS 100% 4.050 5.670 N HDDC2 n/a
4 TRCN0000134248 CCATTGTTGGTCTGTTGATTT pLKO.1 718 3UTR 100% 13.200 9.240 N HDDC2 n/a
5 TRCN0000292238 CCATTGTTGGTCTGTTGATTT pLKO_005 718 3UTR 100% 13.200 9.240 N HDDC2 n/a
6 TRCN0000136908 CTGAGATAGTCCAGCTTGTTT pLKO.1 568 CDS 100% 5.625 3.938 N HDDC2 n/a
7 TRCN0000292237 CTGAGATAGTCCAGCTTGTTT pLKO_005 568 CDS 100% 5.625 3.938 N HDDC2 n/a
8 TRCN0000134713 GCTAGACCAATGTGAAATGAT pLKO.1 458 CDS 100% 5.625 3.938 N HDDC2 n/a
9 TRCN0000292179 GCTAGACCAATGTGAAATGAT pLKO_005 458 CDS 100% 5.625 3.938 N HDDC2 n/a
10 TRCN0000134100 CTATGAACTTTGGGAAGAGTA pLKO.1 398 CDS 100% 4.950 3.465 N HDDC2 n/a
11 TRCN0000136853 CCAGATGAAATTGCTGCCTTA pLKO.1 1096 3UTR 100% 4.050 2.835 N HDDC2 n/a
12 TRCN0000138046 CCCAGATGAAATTGCTGCCTT pLKO.1 1095 3UTR 100% 2.640 1.848 N HDDC2 n/a
13 TRCN0000136696 GTTTCTGAACTTGAGGCAGAA pLKO.1 585 CDS 100% 0.405 0.284 N HDDC2 n/a
14 TRCN0000137381 GCCAAATTTGTGAAGCAGCTA pLKO.1 441 CDS 100% 2.640 1.584 N HDDC2 n/a
15 TRCN0000292182 GCCAAATTTGTGAAGCAGCTA pLKO_005 441 CDS 100% 2.640 1.584 N HDDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08196 pDONR223 100% 99.8% 99.5% None 392A>G n/a
2 ccsbBroad304_08196 pLX_304 0% 99.8% 99.5% V5 392A>G n/a
3 TRCN0000477750 TACAGGATTATCATGGATCCATTA pLX_317 35.9% 99.8% 99.5% V5 392A>G n/a
Download CSV