Transcript: Human NM_016100.5

Homo sapiens N(alpha)-acetyltransferase 20, NatB catalytic subunit (NAA20), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
NAA20 (51126)
Length:
1040
CDS:
36..572

Additional Resources:

NCBI RefSeq record:
NM_016100.5
NBCI Gene record:
NAA20 (51126)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016100.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035541 CCGCTTCAACAACATTAACTT pLKO.1 74 CDS 100% 5.625 7.875 N NAA20 n/a
2 TRCN0000290705 CCGCTTCAACAACATTAACTT pLKO_005 74 CDS 100% 5.625 7.875 N NAA20 n/a
3 TRCN0000035543 GTGGAGAATTAATGGGTTATA pLKO.1 184 CDS 100% 13.200 10.560 N NAA20 n/a
4 TRCN0000290708 GTGGAGAATTAATGGGTTATA pLKO_005 184 CDS 100% 13.200 10.560 N NAA20 n/a
5 TRCN0000114568 GTTCCGCTTCAACAACATTAA pLKO.1 71 CDS 100% 13.200 9.240 N Naa20 n/a
6 TRCN0000325970 GTTCCGCTTCAACAACATTAA pLKO_005 71 CDS 100% 13.200 9.240 N Naa20 n/a
7 TRCN0000035542 GACGCTTATGATATGAGGAAA pLKO.1 477 CDS 100% 4.950 3.465 N NAA20 n/a
8 TRCN0000290774 GACGCTTATGATATGAGGAAA pLKO_005 477 CDS 100% 4.950 3.465 N NAA20 n/a
9 TRCN0000035539 GCTGCTAAACTTATGGAGTTA pLKO.1 300 CDS 100% 4.950 3.465 N NAA20 n/a
10 TRCN0000290776 GCTGCTAAACTTATGGAGTTA pLKO_005 300 CDS 100% 4.950 3.465 N NAA20 n/a
11 TRCN0000035540 CCAGGGATACTGAGAAGAAAT pLKO.1 505 CDS 100% 13.200 7.920 N NAA20 n/a
12 TRCN0000290706 CCAGGGATACTGAGAAGAAAT pLKO_005 505 CDS 100% 13.200 7.920 N NAA20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016100.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08226 pDONR223 100% 99.8% 99.4% None 11T>N n/a
2 ccsbBroad304_08226 pLX_304 0% 99.8% 99.4% V5 11T>N n/a
3 TRCN0000473227 TGATCAAAGACGGACTACTCTAAG pLX_317 91.8% 99.8% 99.4% V5 11T>N n/a
Download CSV