Transcript: Human NM_016140.4

Homo sapiens tubulin polymerization promoting protein family member 3 (TPPP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
TPPP3 (51673)
Length:
1112
CDS:
217..747

Additional Resources:

NCBI RefSeq record:
NM_016140.4
NBCI Gene record:
TPPP3 (51673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016140.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244107 GCCAATGTGGGCGTCACTAAA pLKO_005 541 CDS 100% 13.200 18.480 N TPPP3 n/a
2 TRCN0000244106 ACGTGAGCGCCTACAAGAATG pLKO_005 695 CDS 100% 10.800 7.560 N TPPP3 n/a
3 TRCN0000244108 AGGAGAGCTTCCGCAAGTTTG pLKO_005 248 CDS 100% 10.800 7.560 N TPPP3 n/a
4 TRCN0000244109 CTGCTCGGGTCATCAACTATG pLKO_005 413 CDS 100% 10.800 7.560 N TPPP3 n/a
5 TRCN0000179020 CATCGTCTTCTCCAAAGTCAA pLKO.1 384 CDS 100% 4.950 3.465 N TPPP3 n/a
6 TRCN0000179711 GCAAGAGATGAATGGCAAGAA pLKO.1 297 CDS 100% 4.950 3.465 N TPPP3 n/a
7 TRCN0000244105 CTCTTCCTGCTCCAACTTCTG pLKO_005 939 3UTR 100% 4.050 2.835 N TPPP3 n/a
8 TRCN0000122436 GCTGACGGACACCAGCAGATA pLKO.1 588 CDS 100% 1.650 1.155 N TPPP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016140.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03363 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03363 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478386 TTGCAATATTGAAAAATTATCTTT pLX_317 60.4% 100% 100% V5 n/a
Download CSV