Transcript: Human NM_016270.4

Homo sapiens Kruppel like factor 2 (KLF2), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
KLF2 (10365)
Length:
2820
CDS:
99..1166

Additional Resources:

NCBI RefSeq record:
NM_016270.4
NBCI Gene record:
KLF2 (10365)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016270.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414645 ACGATCCTCCTTGACGAGTTT pLKO_005 1373 3UTR 100% 4.950 3.960 N KLF2 n/a
2 TRCN0000020724 CCAAACTGTGACTGGTATTTA pLKO.1 1232 3UTR 100% 15.000 10.500 N KLF2 n/a
3 TRCN0000414182 TTGTGATGCCTTGTGAGAAAT pLKO_005 1466 3UTR 100% 13.200 9.240 N KLF2 n/a
4 TRCN0000418423 CAATAATTTAAGTGGCATCTT pLKO_005 1411 3UTR 100% 4.950 3.465 N KLF2 n/a
5 TRCN0000414519 GCTGCACATGAAACGGCACAT pLKO_005 1142 CDS 100% 4.050 2.835 N KLF2 n/a
6 TRCN0000020725 AGTTCGCATCTGAAGGCGCAT pLKO.1 954 CDS 100% 2.160 1.512 N KLF2 n/a
7 TRCN0000020726 CACCGGCCATTCCAGTGCCAT pLKO.1 1083 CDS 100% 0.000 0.000 N KLF2 n/a
8 TRCN0000020727 CGCCTTTCGGTGGCCCTGGTT pLKO.1 682 CDS 100% 0.000 0.000 N KLF2 n/a
9 TRCN0000020728 CGGCACCGACGACGACCTCAA pLKO.1 203 CDS 100% 0.000 0.000 N KLF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016270.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487834 CGTCGGGTCTGGAAGATCCCGAAA pLX_317 22.4% 99.9% 99.7% V5 (not translated due to prior stop codon) 311T>C n/a
Download CSV