Transcript: Human NM_016338.4

Homo sapiens importin 11 (IPO11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
IPO11 (51194)
Length:
4420
CDS:
191..3118

Additional Resources:

NCBI RefSeq record:
NM_016338.4
NBCI Gene record:
IPO11 (51194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016338.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219952 AGATCAGTTTCTACCGTATTT pLKO.1 1840 CDS 100% 13.200 18.480 N IPO11 n/a
2 TRCN0000160659 CGTTACATTTGAACGATTCAT pLKO.1 1120 CDS 100% 5.625 7.875 N IPO11 n/a
3 TRCN0000219951 CAACCACACTTTGGATATAAA pLKO.1 340 CDS 100% 15.000 12.000 N IPO11 n/a
4 TRCN0000159422 GCTGCGTAAGTTAACTGTTAA pLKO.1 841 CDS 100% 13.200 9.240 N IPO11 n/a
5 TRCN0000160347 CCACTCTTATAGAGTCTGTTA pLKO.1 579 CDS 100% 4.950 3.465 N IPO11 n/a
6 TRCN0000174782 GCAATCTGTAACTTGCTTCAA pLKO.1 1745 CDS 100% 4.950 3.465 N Ipo11 n/a
7 TRCN0000314285 GCAATCTGTAACTTGCTTCAA pLKO_005 1745 CDS 100% 4.950 3.465 N Ipo11 n/a
8 TRCN0000158471 CCACAAATGTTTCAACCGATT pLKO.1 2480 CDS 100% 4.050 2.835 N IPO11 n/a
9 TRCN0000175289 CCATAAGATTAAGATGGCATT pLKO.1 1237 CDS 100% 4.050 2.835 N Ipo11 n/a
10 TRCN0000314348 CCATAAGATTAAGATGGCATT pLKO_005 1237 CDS 100% 4.050 2.835 N Ipo11 n/a
11 TRCN0000165083 GACAACATTACCCAGCCTGAA pLKO.1 2699 CDS 100% 4.050 2.430 N IPO11 n/a
12 TRCN0000160780 CCTTCCTTATTCCTCGAACAT pLKO.1 4087 3UTR 100% 4.950 2.475 Y IPO11 n/a
13 TRCN0000158885 GCTGAGATGAAGAAATCACTT pLKO.1 3196 3UTR 100% 4.950 2.475 Y IPO11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016338.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08248 pDONR223 100% 99.9% 100% None 783G>T n/a
2 ccsbBroad304_08248 pLX_304 0% 99.9% 100% V5 783G>T n/a
3 TRCN0000491664 GTCGCTCCCCGTTACGTCTCCTAC pLX_317 6.8% 99.9% 100% V5 783G>T n/a
Download CSV