Transcript: Human NM_016373.4

Homo sapiens WW domain containing oxidoreductase (WWOX), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
WWOX (51741)
Length:
2241
CDS:
126..1370

Additional Resources:

NCBI RefSeq record:
NM_016373.4
NBCI Gene record:
WWOX (51741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016373.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033839 CCCATCGATTTACAGATATTA pLKO.1 910 CDS 100% 15.000 21.000 N WWOX n/a
2 TRCN0000441801 GGCTAGGCATAGGTCTCTTTG pLKO_005 1576 3UTR 100% 10.800 15.120 N WWOX n/a
3 TRCN0000428967 GTGAAGCAGTGTCACGCATTT pLKO_005 610 CDS 100% 10.800 15.120 N WWOX n/a
4 TRCN0000033843 CCATACGGATGGGAACAAGAA pLKO.1 303 CDS 100% 4.950 6.930 N WWOX n/a
5 TRCN0000430007 ACACAGATCCGCAAGAGTAAA pLKO_005 1463 3UTR 100% 13.200 10.560 N WWOX n/a
6 TRCN0000033841 GCGTTTACTGTGGATGATAAT pLKO.1 396 CDS 100% 13.200 10.560 N WWOX n/a
7 TRCN0000436011 ATATGATGTACTCCAACATTC pLKO_005 1099 CDS 100% 10.800 7.560 N WWOX n/a
8 TRCN0000042116 GAAGCATTCAAGGCCAAGAAT pLKO.1 708 CDS 100% 5.625 3.938 N Wwox n/a
9 TRCN0000033840 GCCAAGAATGTGCCTCTTCAT pLKO.1 720 CDS 100% 4.950 3.465 N WWOX n/a
10 TRCN0000033842 GCTGGCTTATAACAGGTCCAA pLKO.1 995 CDS 100% 2.640 1.848 N WWOX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016373.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12014 pDONR223 100% 56.5% 56.5% None 516_1055del n/a
2 ccsbBroad304_12014 pLX_304 0% 56.5% 56.5% V5 516_1055del n/a
3 TRCN0000477500 GTGAAATTAGTTGTGCGCCCTTTT pLX_317 57.7% 56.5% 56.5% V5 516_1055del n/a
Download CSV