Transcript: Human NM_016388.4

Homo sapiens T cell receptor associated transmembrane adaptor 1 (TRAT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TRAT1 (50852)
Length:
1831
CDS:
143..703

Additional Resources:

NCBI RefSeq record:
NM_016388.4
NBCI Gene record:
TRAT1 (50852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062943 CCGACCAGAGAAATCTGTAAA pLKO.1 394 CDS 100% 13.200 18.480 N TRAT1 n/a
2 TRCN0000062944 CCTCACTTGATCACAGCGTTA pLKO.1 474 CDS 100% 4.050 5.670 N TRAT1 n/a
3 TRCN0000062945 CAGCGTTTCTAAGACCACCTT pLKO.1 577 CDS 100% 2.640 3.696 N TRAT1 n/a
4 TRCN0000062946 ACCAGGGTTGATGAGTATTAT pLKO.1 290 CDS 100% 15.000 10.500 N TRAT1 n/a
5 TRCN0000414074 TGCTAAGAGAGAACCTATAAA pLKO_005 679 CDS 100% 15.000 10.500 N TRAT1 n/a
6 TRCN0000416754 CATGATCTAGTTCAATGATTT pLKO_005 710 3UTR 100% 13.200 9.240 N TRAT1 n/a
7 TRCN0000412964 ATACCTAATACTTAGGGAAAT pLKO_005 1027 3UTR 100% 10.800 7.560 N TRAT1 n/a
8 TRCN0000062947 GATGAGCAACTACATGCAATA pLKO.1 551 CDS 100% 10.800 7.560 N TRAT1 n/a
9 TRCN0000436059 TATGGTAACTTAGATGATATG pLKO_005 329 CDS 100% 10.800 7.560 N TRAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016388.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03157 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03157 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467926 CATGTCGTGCGTGCCCTGTCCCAC pLX_317 75.6% 100% 100% V5 n/a
Download CSV