Transcript: Human NM_016500.5

Homo sapiens polysaccharide biosynthesis domain containing 1 (PBDC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PBDC1 (51260)
Length:
1185
CDS:
78..779

Additional Resources:

NCBI RefSeq record:
NM_016500.5
NBCI Gene record:
PBDC1 (51260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016500.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446427 TCGGAACCGGGAAGGCTATAA pLKO_005 521 CDS 100% 13.200 18.480 N PBDC1 n/a
2 TRCN0000427020 TGGTACTTTGCTGCGACTAGA pLKO_005 428 CDS 100% 4.950 6.930 N PBDC1 n/a
3 TRCN0000436558 GCAGCATGCTGAAGTCTATTA pLKO_005 209 CDS 100% 13.200 9.240 N PBDC1 n/a
4 TRCN0000416725 AGGACATCTTTCTAGTCTAAC pLKO_005 901 3UTR 100% 10.800 7.560 N PBDC1 n/a
5 TRCN0000178664 CACCAAAGTAGATGACCAAAT pLKO.1 269 CDS 100% 10.800 7.560 N Pbdc1 n/a
6 TRCN0000168561 GAGCTGATAGTGGAGAAGAAA pLKO.1 658 CDS 100% 5.625 3.938 N PBDC1 n/a
7 TRCN0000172931 GAGGCCATTCTGCTTGAAGTT pLKO.1 380 CDS 100% 4.950 3.465 N PBDC1 n/a
8 TRCN0000168594 GAGTCAACAATGGAGGAGAAA pLKO.1 586 CDS 100% 4.950 3.465 N PBDC1 n/a
9 TRCN0000168208 CTCAAGTCAGAATCAGCCAAA pLKO.1 351 CDS 100% 4.050 2.835 N PBDC1 n/a
10 TRCN0000446509 TGTCTGTGGCACATGCGCTTT pLKO_005 124 CDS 100% 4.050 2.835 N PBDC1 n/a
11 TRCN0000338049 AGCATGCTGAAGTCTATTATA pLKO_005 211 CDS 100% 15.000 10.500 N Pbdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016500.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03260 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03260 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467029 CCCACTCCTTGTCATCCAGAGAGG pLX_317 56% 100% 100% V5 n/a
Download CSV