Transcript: Human NM_016533.6

Homo sapiens ninjurin 2 (NINJ2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NINJ2 (4815)
Length:
918
CDS:
86..514

Additional Resources:

NCBI RefSeq record:
NM_016533.6
NBCI Gene record:
NINJ2 (4815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016533.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063776 CCTGTTCATGTCCAACGCCAT pLKO.1 208 CDS 100% 2.160 3.024 N NINJ2 n/a
2 TRCN0000063773 CGTGGTCATTGCACGGCTGAA pLKO.1 337 CDS 100% 1.350 1.080 N NINJ2 n/a
3 TRCN0000063775 CTGAACCTGAATGAGGTAGAA pLKO.1 353 CDS 100% 4.950 3.465 N NINJ2 n/a
4 TRCN0000063774 ACATCGACCTTCAACCTGGAA pLKO.1 105 CDS 100% 2.640 1.848 N NINJ2 n/a
5 TRCN0000063777 GCAGCGAGATGGAATCAGCAA pLKO.1 78 5UTR 100% 2.640 1.848 N NINJ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016533.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10998 pDONR223 100% 99.7% 100% None 405C>A n/a
2 ccsbBroad304_10998 pLX_304 0% 99.7% 100% V5 405C>A n/a
3 TRCN0000475170 AGCCCAACGAGTGCGATAGTGCGA pLX_317 82.2% 99.7% 100% V5 405C>A n/a
Download CSV