Transcript: Human NM_016585.5

Homo sapiens theg spermatid protein (THEG), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
THEG (51298)
Length:
1649
CDS:
57..1196

Additional Resources:

NCBI RefSeq record:
NM_016585.5
NBCI Gene record:
THEG (51298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016585.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151453 CGAAGATTCGTGATAACTTCT pLKO.1 769 CDS 100% 4.950 6.930 N THEG n/a
2 TRCN0000157122 GAGCCCAAGATAAACTGGCAA pLKO.1 453 CDS 100% 2.640 2.112 N THEG n/a
3 TRCN0000157121 GCACTTTCTGAGTTGGAGAGA pLKO.1 303 CDS 100% 2.640 2.112 N THEG n/a
4 TRCN0000157153 GATCCCAAAGAGGCACTTTCT pLKO.1 291 CDS 100% 4.950 3.465 N THEG n/a
5 TRCN0000157324 CCATGACCAAAGCAAGGAAGA pLKO.1 400 CDS 100% 4.050 2.835 N THEG n/a
6 TRCN0000156513 GCCCAAGATAAACTGGCAAGT pLKO.1 455 CDS 100% 4.050 2.835 N THEG n/a
7 TRCN0000157029 GATGAGCTTGCACTTCTGTCT pLKO.1 533 CDS 100% 2.640 1.848 N THEG n/a
8 TRCN0000157074 GCAAGTCCTGAAAGACAGGAA pLKO.1 470 CDS 100% 0.264 0.185 N THEG n/a
9 TRCN0000157700 CAAGGACTTGGAAGAGGACAT pLKO.1 332 CDS 100% 4.050 2.025 Y THEG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016585.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03273 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03273 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469837 ATGAATTGTCTACTAAATAAACTA pLX_317 7.2% 100% 100% V5 n/a
Download CSV