Transcript: Mouse NM_016678.2

Mus musculus reversion-inducing-cysteine-rich protein with kazal motifs (Reck), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Reck (53614)
Length:
4450
CDS:
77..2992

Additional Resources:

NCBI RefSeq record:
NM_016678.2
NBCI Gene record:
Reck (53614)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080132 CCACGGAACATCCTTTACTAT pLKO.1 1843 CDS 100% 5.625 7.875 N Reck n/a
2 TRCN0000080130 CGGGTATTATTTGACAAAGAA pLKO.1 2573 CDS 100% 5.625 7.875 N Reck n/a
3 TRCN0000313814 CTGGGATGTTACGGGTATTAT pLKO_005 2562 CDS 100% 15.000 10.500 N Reck n/a
4 TRCN0000313816 GACCGCATCTGTGAGTATAAT pLKO_005 1043 CDS 100% 15.000 10.500 N Reck n/a
5 TRCN0000375144 GACCTCCAGAAGTCTTGTATT pLKO_005 1802 CDS 100% 13.200 9.240 N Reck n/a
6 TRCN0000313815 TTGAGCATCGAGTCGGAAATT pLKO_005 2705 CDS 100% 13.200 9.240 N Reck n/a
7 TRCN0000375145 GGTCTCATTGAGGGTTGTAAG pLKO_005 809 CDS 100% 10.800 7.560 N Reck n/a
8 TRCN0000080129 GCCCTGAAACAATGGTTGAAA pLKO.1 297 CDS 100% 5.625 3.938 N Reck n/a
9 TRCN0000080128 CCGTGTTGTGTTAGCCAGATA pLKO.1 3649 3UTR 100% 4.950 3.465 N Reck n/a
10 TRCN0000317336 CCGTGTTGTGTTAGCCAGATA pLKO_005 3649 3UTR 100% 4.950 3.465 N Reck n/a
11 TRCN0000080131 CCTGAAACAATGGTTGAAATT pLKO.1 299 CDS 100% 13.200 7.920 N Reck n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11272 pDONR223 100% 20.8% 20.5% None (many diffs) n/a
2 ccsbBroad304_11272 pLX_304 0% 20.8% 20.5% V5 (many diffs) n/a
3 TRCN0000465287 CCCACCGCCAACCTTGGGCGTTCT pLX_317 50.9% 20.8% 20.5% V5 (many diffs) n/a
Download CSV