Transcript: Mouse NM_016679.4

Mus musculus kelch-like ECH-associated protein 1 (Keap1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Keap1 (50868)
Length:
4470
CDS:
1624..3498

Additional Resources:

NCBI RefSeq record:
NM_016679.4
NBCI Gene record:
Keap1 (50868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016679.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295014 CCTGCAACTCGGTGATCAATT pLKO_005 3852 3UTR 100% 13.200 9.240 N Keap1 n/a
2 TRCN0000295015 GGATGATCACACCGATGAATA pLKO_005 3116 CDS 100% 13.200 9.240 N Keap1 n/a
3 TRCN0000295016 GTGCATCGACTGGGTCAAATA pLKO_005 2367 CDS 100% 13.200 9.240 N Keap1 n/a
4 TRCN0000099448 CCAATGTTGACACGGAGGATT pLKO.1 2986 CDS 100% 4.950 3.465 N Keap1 n/a
5 TRCN0000099447 CGGAAGCAAATTGATCAACAA pLKO.1 3463 CDS 100% 4.950 3.465 N Keap1 n/a
6 TRCN0000287664 CGGAAGCAAATTGATCAACAA pLKO_005 3463 CDS 100% 4.950 3.465 N Keap1 n/a
7 TRCN0000099445 GCACTGACAACAGGACAGAAA pLKO.1 3517 3UTR 100% 4.950 3.465 N Keap1 n/a
8 TRCN0000099446 GCCCAATTCATGGCTCACAAA pLKO.1 1894 CDS 100% 4.950 3.465 N Keap1 n/a
9 TRCN0000099449 CCTAAGGTCATGGAAAGGCTT pLKO.1 2011 CDS 100% 2.640 1.848 N Keap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016679.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10450 pDONR223 100% 86.2% 93.9% None (many diffs) n/a
2 ccsbBroad304_10450 pLX_304 0% 86.2% 93.9% V5 (many diffs) n/a
Download CSV