Transcript: Mouse NM_016689.2

Mus musculus aquaporin 3 (Aqp3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Aqp3 (11828)
Length:
1763
CDS:
75..953

Additional Resources:

NCBI RefSeq record:
NM_016689.2
NBCI Gene record:
Aqp3 (11828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426908 CAAGGTAGGATAGCAAATAAG pLKO_005 1150 3UTR 100% 13.200 18.480 N Aqp3 n/a
2 TRCN0000102168 AGCTGGAATCTTTGCCACCTA pLKO.1 503 CDS 100% 2.640 3.696 N Aqp3 n/a
3 TRCN0000415505 TGATGCCTCTCTCGGGCTAAA pLKO_005 1037 3UTR 100% 10.800 8.640 N Aqp3 n/a
4 TRCN0000435117 CATCGCTGGTGTCTTCGTGTA pLKO_005 836 CDS 100% 4.050 3.240 N Aqp3 n/a
5 TRCN0000439981 GCCATCGTTGACCCTTATAAC pLKO_005 603 CDS 100% 13.200 9.240 N Aqp3 n/a
6 TRCN0000102169 CCTTTGCCAACAATGAGCTTT pLKO.1 460 CDS 100% 4.950 3.465 N Aqp3 n/a
7 TRCN0000102165 GCTGTGTAATATGTTTCTGTT pLKO.1 1526 3UTR 100% 4.950 3.465 N Aqp3 n/a
8 TRCN0000102166 TGGGCTGTACTACGATGCAAT pLKO.1 434 CDS 100% 4.950 3.465 N Aqp3 n/a
9 TRCN0000102167 CATGGGCTTCAATTCTGGCTA pLKO.1 689 CDS 100% 2.640 1.848 N Aqp3 n/a
10 TRCN0000417941 TGGATCAAGCTGCCCATCTAC pLKO_005 366 CDS 100% 4.950 3.465 N AQP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00089 pDONR223 100% 88.3% 95.5% None (many diffs) n/a
2 ccsbBroad304_00089 pLX_304 0% 88.3% 95.5% V5 (many diffs) n/a
3 TRCN0000480907 AGCCCAGGAGCAACAAGGTCACTA pLX_317 53% 88.3% 95.5% V5 (many diffs) n/a
Download CSV