Transcript: Mouse NM_016711.3

Mus musculus tropomodulin 2 (Tmod2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tmod2 (50876)
Length:
9893
CDS:
370..1425

Additional Resources:

NCBI RefSeq record:
NM_016711.3
NBCI Gene record:
Tmod2 (50876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042766 GTCTAAACGTAGAGTCCAATT pLKO.1 1142 CDS 100% 10.800 15.120 N Tmod2 n/a
2 TRCN0000042763 CCTCAACAACATTAAGAACAT pLKO.1 978 CDS 100% 4.950 3.465 N Tmod2 n/a
3 TRCN0000042764 CCTGTGAGGAATGTCGTGAAA pLKO.1 853 CDS 100% 4.950 3.465 N Tmod2 n/a
4 TRCN0000042767 GTTCGAAAGAAGAGAGTTGAA pLKO.1 1390 CDS 100% 4.950 3.465 N Tmod2 n/a
5 TRCN0000063852 AGGAACTGAAACAGTTGGAAA pLKO.1 449 CDS 100% 4.950 2.970 N TMOD2 n/a
6 TRCN0000042765 CCTGCTGGATTCCGACAGAAA pLKO.1 508 CDS 100% 4.950 2.970 N Tmod2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8248 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016711.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03091 pDONR223 100% 90% 95.1% None (many diffs) n/a
2 ccsbBroad304_03091 pLX_304 0% 90% 95.1% V5 (many diffs) n/a
3 TRCN0000467059 CCGGAGGTCTCTCACAATCTACTA pLX_317 40.8% 90% 95.1% V5 (many diffs) n/a
Download CSV