Transcript: Mouse NM_016744.4

Mus musculus phosphodiesterase 1A, calmodulin-dependent (Pde1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pde1a (18573)
Length:
4309
CDS:
138..1775

Additional Resources:

NCBI RefSeq record:
NM_016744.4
NBCI Gene record:
Pde1a (18573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016744.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114997 GCTTCAACTTTCACACGCAAA pLKO.1 429 CDS 100% 4.050 5.670 N Pde1a n/a
2 TRCN0000114999 GCTGAATTAGGGCTTCCATTT pLKO.1 1323 CDS 100% 10.800 7.560 N Pde1a n/a
3 TRCN0000114998 GCTTCAAGATTCCTGTTTCTT pLKO.1 712 CDS 100% 5.625 3.938 N Pde1a n/a
4 TRCN0000115000 AGGAAGAACTATCACATGGTT pLKO.1 543 CDS 100% 3.000 2.100 N Pde1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016744.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491875 AGCGCGGCTCCTGCCAGGGAAGCG pLX_317 37% 62.8% 66.2% V5 (many diffs) n/a
Download CSV