Transcript: Mouse NM_016784.3

Mus musculus pleiotropic regulator 1 (Plrg1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Plrg1 (53317)
Length:
1771
CDS:
109..1650

Additional Resources:

NCBI RefSeq record:
NM_016784.3
NBCI Gene record:
Plrg1 (53317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123537 CGGTCAGAAAGTCGGTTACTA pLKO.1 1519 CDS 100% 5.625 7.875 N Plrg1 n/a
2 TRCN0000332098 CGGTCAGAAAGTCGGTTACTA pLKO_005 1519 CDS 100% 5.625 7.875 N Plrg1 n/a
3 TRCN0000420011 GACTTGGCTAGTGGCAAATTA pLKO_005 799 CDS 100% 15.000 12.000 N PLRG1 n/a
4 TRCN0000123536 CGTGGAAACTCTACAGGGTTA pLKO.1 683 CDS 100% 4.050 3.240 N Plrg1 n/a
5 TRCN0000332101 CGTGGAAACTCTACAGGGTTA pLKO_005 683 CDS 100% 4.050 3.240 N Plrg1 n/a
6 TRCN0000123535 CCAGAGTTGATGCAAATCGTA pLKO.1 509 CDS 100% 3.000 2.400 N Plrg1 n/a
7 TRCN0000332099 CCAGAGTTGATGCAAATCGTA pLKO_005 509 CDS 100% 3.000 2.400 N Plrg1 n/a
8 TRCN0000123534 CCTGGAAATCAGTGGTTCGTT pLKO.1 745 CDS 100% 3.000 2.400 N Plrg1 n/a
9 TRCN0000332032 CCTGGAAATCAGTGGTTCGTT pLKO_005 745 CDS 100% 3.000 2.400 N Plrg1 n/a
10 TRCN0000123538 GCCCACAGCAATGAATTCTAT pLKO.1 582 CDS 100% 0.000 0.000 N Plrg1 n/a
11 TRCN0000332100 GCCCACAGCAATGAATTCTAT pLKO_005 582 CDS 100% 0.000 0.000 N Plrg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11033 pDONR223 100% 87.2% 94.5% None (many diffs) n/a
2 ccsbBroad304_11033 pLX_304 0% 87.2% 94.5% V5 (many diffs) n/a
3 TRCN0000468933 ATTACGCCTGGACTGGTGATTTAC pLX_317 30.2% 87.2% 94.5% V5 (many diffs) n/a
Download CSV