Transcript: Mouse NM_016804.4

Mus musculus metaxin 2 (Mtx2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mtx2 (53375)
Length:
1258
CDS:
193..984

Additional Resources:

NCBI RefSeq record:
NM_016804.4
NBCI Gene record:
Mtx2 (53375)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016804.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311300 GTAGGGCAAATGCGGAATATA pLKO_005 368 CDS 100% 15.000 21.000 N Mtx2 n/a
2 TRCN0000114192 GCCCAATAGTCCAATTTGTTA pLKO.1 449 CDS 100% 5.625 7.875 N Mtx2 n/a
3 TRCN0000309382 GCCCAATAGTCCAATTTGTTA pLKO_005 449 CDS 100% 5.625 7.875 N Mtx2 n/a
4 TRCN0000305323 GGTTGTCTTAGAGCCATATAC pLKO_005 974 CDS 100% 13.200 10.560 N Mtx2 n/a
5 TRCN0000114194 GAAACGTAAGATGAAAGCTAT pLKO.1 687 CDS 100% 4.950 3.960 N Mtx2 n/a
6 TRCN0000114193 GAGATCACTATTGCTAGGTAT pLKO.1 607 CDS 100% 4.950 3.960 N Mtx2 n/a
7 TRCN0000309383 GAGATCACTATTGCTAGGTAT pLKO_005 607 CDS 100% 4.950 3.960 N Mtx2 n/a
8 TRCN0000114195 CTGGACCAGGTCTTAGAAGAT pLKO.1 727 CDS 100% 4.950 3.465 N Mtx2 n/a
9 TRCN0000305324 TACTTGAACAATATGGTAGTA pLKO_005 1038 3UTR 100% 4.950 2.970 N Mtx2 n/a
10 TRCN0000059752 CATGTGGGAAATCAAGTAGTA pLKO.1 418 CDS 100% 4.950 3.960 N MTX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016804.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02496 pDONR223 100% 92.1% 96.9% None (many diffs) n/a
2 ccsbBroad304_02496 pLX_304 0% 92.1% 96.9% V5 (many diffs) n/a
3 TRCN0000481272 GGACACCCATTCTAAATTTGTTTT pLX_317 42.3% 92.1% 96.9% V5 (many diffs) n/a
Download CSV