Transcript: Mouse NM_016843.3

Mus musculus ataxin 10 (Atxn10), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Atxn10 (54138)
Length:
2425
CDS:
85..1512

Additional Resources:

NCBI RefSeq record:
NM_016843.3
NBCI Gene record:
Atxn10 (54138)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016843.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277015 ACTCGCTTTCCCGTCATATAC pLKO_005 1723 3UTR 100% 13.200 18.480 N Atxn10 n/a
2 TRCN0000277014 ACTGATTCTGAAGTCTAATAA pLKO_005 1473 CDS 100% 15.000 12.000 N Atxn10 n/a
3 TRCN0000178777 CAAGATGTCATTGCCAAGATG pLKO.1 1381 CDS 100% 4.950 3.465 N Atxn10 n/a
4 TRCN0000179894 CCAAGATGTCATTGCCAAGAT pLKO.1 1380 CDS 100% 4.950 3.465 N Atxn10 n/a
5 TRCN0000285824 CCAAGATGTCATTGCCAAGAT pLKO_005 1380 CDS 100% 4.950 3.465 N Atxn10 n/a
6 TRCN0000183365 GTTCTTCTCTTTCGTGAACTT pLKO.1 427 CDS 100% 4.950 3.465 N Atxn10 n/a
7 TRCN0000285823 GTTCTTCTCTTTCGTGAACTT pLKO_005 427 CDS 100% 4.950 3.465 N Atxn10 n/a
8 TRCN0000179191 GCAGCTAATCACTGAATGCTT pLKO.1 318 CDS 100% 3.000 2.100 N Atxn10 n/a
9 TRCN0000277023 GCAGCTAATCACTGAATGCTT pLKO_005 318 CDS 100% 3.000 2.100 N Atxn10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016843.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.