Transcript: Mouse NM_016899.4

Mus musculus RAB25, member RAS oncogene family (Rab25), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rab25 (53868)
Length:
1060
CDS:
205..846

Additional Resources:

NCBI RefSeq record:
NM_016899.4
NBCI Gene record:
Rab25 (53868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016899.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238208 CATGCCGAAGCCACGATTGTT pLKO_005 541 CDS 100% 5.625 7.875 N Rab25 n/a
2 TRCN0000381628 GGTTCACCCGCAATGAGTTCA pLKO_005 296 CDS 100% 4.950 6.930 N Rab25 n/a
3 TRCN0000238204 ATGAGTTCAGCCACGACAGTC pLKO_005 308 CDS 100% 4.050 3.240 N Rab25 n/a
4 TRCN0000380836 CACGATTGTTGTCATGCTCGT pLKO_005 552 CDS 100% 2.160 1.728 N Rab25 n/a
5 TRCN0000238205 GTTCTCCACCCGCACTGTAAT pLKO_005 348 CDS 100% 13.200 9.240 N Rab25 n/a
6 TRCN0000382461 ACTGAGGAGGCCTGCATGTTT pLKO_005 613 CDS 100% 5.625 3.938 N Rab25 n/a
7 TRCN0000380027 ACTGTCCTCAAAGAGATCTTT pLKO_005 706 CDS 100% 5.625 3.938 N Rab25 n/a
8 TRCN0000238206 ATATCTCCACCTCCCTTACTG pLKO_005 889 3UTR 100% 4.950 3.465 N Rab25 n/a
9 TRCN0000380106 TTGCATCAGCCTCTGACTTCA pLKO_005 831 CDS 100% 4.950 3.465 N Rab25 n/a
10 TRCN0000380951 GGAGAGATACAGAGCCATCAC pLKO_005 417 CDS 100% 4.050 2.835 N Rab25 n/a
11 TRCN0000380872 TCTTTAAGGTGGTGCTGATCG pLKO_005 239 CDS 100% 4.050 2.835 N Rab25 n/a
12 TRCN0000381856 TGTGGTGGAGCGCTGGCTAAA pLKO_005 507 CDS 100% 3.600 2.520 N Rab25 n/a
13 TRCN0000100251 CCTGGTATTTGACCTGACCAA pLKO.1 471 CDS 100% 2.640 1.848 N Rab25 n/a
14 TRCN0000379610 AGCTGTATGACCATGCCGAAG pLKO_005 530 CDS 100% 2.250 1.575 N Rab25 n/a
15 TRCN0000100253 CTTTGTCTTTAAGGTGGTGCT pLKO.1 234 CDS 100% 2.160 1.512 N Rab25 n/a
16 TRCN0000379673 GAGATCTTTGCAAAGGTGTCC pLKO_005 718 CDS 100% 2.160 1.512 N Rab25 n/a
17 TRCN0000100252 GCCCTCGACTCCACCAATGTT pLKO.1 670 CDS 100% 1.875 1.313 N Rab25 n/a
18 TRCN0000382355 AGCCCTCGACTCCACCAATGT pLKO_005 669 CDS 100% 1.650 1.155 N Rab25 n/a
19 TRCN0000381416 CTGACCAAGCACCAGACCTAC pLKO_005 484 CDS 100% 1.350 0.945 N Rab25 n/a
20 TRCN0000381399 TCTGACTTCAGCTATGGCCAG pLKO_005 842 CDS 100% 1.200 0.840 N Rab25 n/a
21 TRCN0000381210 ATCACCCTGGGCAATGCCCAA pLKO_005 772 CDS 100% 0.720 0.504 N Rab25 n/a
22 TRCN0000100254 CCTCAAAGAGATCTTTGCAAA pLKO.1 711 CDS 100% 0.495 0.347 N Rab25 n/a
23 TRCN0000238207 GCTGGCTAAAGGAGCTGTATG pLKO_005 518 CDS 100% 10.800 6.480 N Rab25 n/a
24 TRCN0000100250 CCTGCCTTCAGCTTTCAGATA pLKO.1 871 3UTR 100% 4.950 2.970 N Rab25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016899.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03784 pDONR223 100% 90.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_03784 pLX_304 0% 90.6% 95.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466868 TCACATTCTACTCATCCACCATGC pLX_317 56.8% 90.6% 95.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV