Transcript: Mouse NM_016909.2

Mus musculus translin-associated factor X (Tsnax), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tsnax (53424)
Length:
2391
CDS:
201..1073

Additional Resources:

NCBI RefSeq record:
NM_016909.2
NBCI Gene record:
Tsnax (53424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240852 GACGCCAGGCACGACAAATAT pLKO_005 339 CDS 100% 15.000 21.000 N Tsnax n/a
2 TRCN0000240849 ACGCTTGCTATGCCCTTAAAG pLKO_005 964 CDS 100% 13.200 18.480 N Tsnax n/a
3 TRCN0000219464 ACGATGGGTTCTCGTTCATTG pLKO.1 874 CDS 100% 10.800 15.120 N Tsnax n/a
4 TRCN0000193301 CGTTCATTGATCAGTATGGAA pLKO.1 618 CDS 100% 3.000 4.200 N Tsnax n/a
5 TRCN0000219463 TGAAGCTAAGCCGGGATATTA pLKO.1 370 CDS 100% 15.000 10.500 N Tsnax n/a
6 TRCN0000240850 CGGTGATGCTGGCCTTCAAAT pLKO_005 301 CDS 100% 13.200 9.240 N Tsnax n/a
7 TRCN0000240853 TGTATATGTGCTCGCTCTATT pLKO_005 1265 3UTR 100% 13.200 9.240 N Tsnax n/a
8 TRCN0000240851 TGATCAGGAAGAGAGCATTTC pLKO_005 1049 CDS 100% 10.800 7.560 N Tsnax n/a
9 TRCN0000174862 GATTAACAAGCAGTTGACATT pLKO.1 641 CDS 100% 4.950 3.465 N Tsnax n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01718 pDONR223 100% 85.7% 90.6% None (many diffs) n/a
2 ccsbBroad304_01718 pLX_304 0% 85.7% 90.6% V5 (many diffs) n/a
3 TRCN0000472121 CGTGGCCTAATTTCCCAGTTTGCC pLX_317 42.4% 85.7% 90.6% V5 (many diffs) n/a
Download CSV