Transcript: Mouse NM_016959.4

Mus musculus ribosomal protein S3A1 (Rps3a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rps3a1 (20091)
Length:
960
CDS:
100..894

Additional Resources:

NCBI RefSeq record:
NM_016959.4
NBCI Gene record:
Rps3a1 (20091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016959.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104149 AGAATGATGAAGTTGCGTTTA pLKO.1 323 CDS 100% 10.800 15.120 N Rps3a1 n/a
2 TRCN0000074709 CCGGAAGAAGATGATGGAAAT pLKO.1 591 CDS 100% 10.800 7.560 N RPS3A n/a
3 TRCN0000289167 CCGGAAGAAGATGATGGAAAT pLKO_005 591 CDS 100% 10.800 7.560 N RPS3A n/a
4 TRCN0000104148 GCATTGGGAAAGACATAGAAA pLKO.1 674 CDS 100% 5.625 3.938 N Rps3a1 n/a
5 TRCN0000104146 CAGATAAGAAAGACATCCTAT pLKO.1 544 CDS 100% 4.950 3.465 N Rps3a1 n/a
6 TRCN0000104145 CGTGTGTTTGAAGTGAGCCTT pLKO.1 292 CDS 100% 2.640 1.848 N Rps3a1 n/a
7 TRCN0000104147 GCTAAGAAGAAAGTGGTCGAT pLKO.1 148 CDS 100% 2.640 1.584 N Rps3a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016959.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01446 pDONR223 100% 89.2% 99.2% None (many diffs) n/a
2 ccsbBroad304_01446 pLX_304 0% 89.2% 99.2% V5 (many diffs) n/a
3 TRCN0000479730 GCTGACGAATGTTAATAATTAATC pLX_317 54.1% 89.2% 99.2% V5 (many diffs) n/a
Download CSV