Transcript: Mouse NM_017368.3

Mus musculus CUGBP, Elav-like family member 1 (Celf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Celf1 (13046)
Length:
4873
CDS:
327..1868

Additional Resources:

NCBI RefSeq record:
NM_017368.3
NBCI Gene record:
Celf1 (13046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098514 ACTCTGTACAACCAGAATTTA pLKO.1 1533 CDS 100% 15.000 21.000 N Celf1 n/a
2 TRCN0000326844 ACTCTGTACAACCAGAATTTA pLKO_005 1533 CDS 100% 15.000 21.000 N Celf1 n/a
3 TRCN0000098513 CCAGTACTTAGCACTTTATTT pLKO.1 1082 CDS 100% 15.000 21.000 N Celf1 n/a
4 TRCN0000098511 CGTATTCTGGTATCCAGCAAT pLKO.1 1492 CDS 100% 4.950 3.960 N Celf1 n/a
5 TRCN0000326780 CGTATTCTGGTATCCAGCAAT pLKO_005 1492 CDS 100% 4.950 3.960 N Celf1 n/a
6 TRCN0000098512 CCCAGTACTTAGCACTTTATT pLKO.1 1081 CDS 100% 15.000 10.500 N Celf1 n/a
7 TRCN0000326781 CCCAGTACTTAGCACTTTATT pLKO_005 1081 CDS 100% 15.000 10.500 N Celf1 n/a
8 TRCN0000098510 CGTCAAGTACATCGTCCAAAT pLKO.1 1952 3UTR 100% 10.800 7.560 N Celf1 n/a
9 TRCN0000233076 CGTCAAGTACATCGTCCAAAT pLKO_005 1952 3UTR 100% 10.800 7.560 N CELF1 n/a
10 TRCN0000326898 CGTCAAGTACATCGTCCAAAT pLKO_005 1952 3UTR 100% 10.800 7.560 N Celf1 n/a
11 TRCN0000221655 GCTGCATTAGAAGCTCAGAAT pLKO.1 618 CDS 100% 4.950 3.465 N CELF1 n/a
12 TRCN0000221658 CTTGATGCTATCAAGATGTTT pLKO.1 444 CDS 100% 0.563 0.394 N CELF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017368.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.