Transcript: Human NM_017425.3

Homo sapiens sperm autoantigenic protein 17 (SPA17), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
SPA17 (53340)
Length:
955
CDS:
137..592

Additional Resources:

NCBI RefSeq record:
NM_017425.3
NBCI Gene record:
SPA17 (53340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017425.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330502 TGAGAGAGCAACCGGACAATA pLKO_005 219 CDS 100% 13.200 9.240 N SPA17 n/a
2 TRCN0000178849 CCACAAGGATTTGGGAATCTT pLKO.1 173 CDS 100% 5.625 3.938 N SPA17 n/a
3 TRCN0000330500 CCACAAGGATTTGGGAATCTT pLKO_005 173 CDS 100% 5.625 3.938 N SPA17 n/a
4 TRCN0000078788 ACCGGACAATATACCAGCTTT pLKO.1 229 CDS 100% 4.950 3.465 N Spa17 n/a
5 TRCN0000326953 ACCGGACAATATACCAGCTTT pLKO_005 229 CDS 100% 4.950 3.465 N Spa17 n/a
6 TRCN0000178778 CAGTCACCATCTTAGACTCTT pLKO.1 435 CDS 100% 4.950 3.465 N SPA17 n/a
7 TRCN0000330459 CAGTCACCATCTTAGACTCTT pLKO_005 435 CDS 100% 4.950 3.465 N SPA17 n/a
8 TRCN0000181166 CATGCATTCGAGGAGCAAGAA pLKO.1 350 CDS 100% 4.950 3.465 N SPA17 n/a
9 TRCN0000330501 CATGCATTCGAGGAGCAAGAA pLKO_005 350 CDS 100% 4.950 3.465 N SPA17 n/a
10 TRCN0000146362 CATTGAAACATGCCACTTGAA pLKO.1 752 3UTR 100% 4.950 3.465 N SPA17 n/a
11 TRCN0000078792 CTACCGAATTCCACAAGGATT pLKO.1 163 CDS 100% 0.000 0.000 N Spa17 n/a
12 TRCN0000330460 ATCCATCAACCTTCTTATTAA pLKO_005 635 3UTR 100% 15.000 9.000 N SPA17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017425.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03386 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03386 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474633 AATTTCAACTACACATACCGGTAC pLX_317 80.7% 100% 100% V5 n/a
Download CSV