Transcript: Human NM_017457.5

Homo sapiens cytohesin 2 (CYTH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CYTH2 (9266)
Length:
4625
CDS:
301..1503

Additional Resources:

NCBI RefSeq record:
NM_017457.5
NBCI Gene record:
CYTH2 (9266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017457.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233533 CTGTACGACAGCATCCGAAAT pLKO_005 1000 CDS 100% 10.800 15.120 N CYTH2 n/a
2 TRCN0000062099 GCGGATTTCAGTCAAGAAGAA pLKO.1 1467 CDS 100% 4.950 3.960 N CYTH2 n/a
3 TRCN0000379723 AGTAAAGGGAGAAGGTTAATA pLKO_005 1841 3UTR 100% 15.000 10.500 N CYTH2 n/a
4 TRCN0000233535 CAGCGAGAAAGAAGCGGATTT pLKO_005 1454 CDS 100% 10.800 7.560 N CYTH2 n/a
5 TRCN0000233534 CCGAACTGCTTTGAACTTTAC pLKO_005 1258 CDS 100% 10.800 7.560 N CYTH2 n/a
6 TRCN0000381561 GGGAGTCTGGAGTTGGAATTG pLKO_005 1866 3UTR 100% 10.800 7.560 N CYTH2 n/a
7 TRCN0000062101 CAGTTCTTGGTGGAGAATGAA pLKO.1 541 CDS 100% 5.625 3.938 N CYTH2 n/a
8 TRCN0000062100 CGGAAACCGAACTGCTTTGAA pLKO.1 1252 CDS 100% 5.625 3.938 N CYTH2 n/a
9 TRCN0000062098 TCCATTATTTATTACGGAGCT pLKO.1 1519 3UTR 100% 2.160 1.296 N CYTH2 n/a
10 TRCN0000233536 TCCATTATTTATTACGGAGCT pLKO_005 1519 3UTR 100% 2.160 1.296 N CYTH2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4063 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4063 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017457.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15663 pDONR223 0% 36.8% 39.5% None (many diffs) n/a
2 ccsbBroad304_15663 pLX_304 0% 36.8% 39.5% V5 (many diffs) n/a
3 TRCN0000467209 ATCGCCCAGGGTACGTTCCTAGCC pLX_317 8% 36.8% 39.5% V5 (many diffs) n/a
Download CSV