Construct: ORF TRCN0000467209
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010143.1_s317c1
- Derived from:
- ccsbBroadEn_15663
- DNA Barcode:
- ATCGCCCAGGGTACGTTCCTAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CYTH3 (9265)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467209
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9265 | CYTH3 | cytohesin 3 | NM_001367581.1 | 77% | 77.1% | 1_159del;531T>G |
2 | human | 9265 | CYTH3 | cytohesin 3 | NM_001367582.1 | 77% | 77.1% | 1_159del;531T>G |
3 | human | 9265 | CYTH3 | cytohesin 3 | NM_001367580.1 | 56.9% | 57% | 1_405del;777T>G |
4 | human | 9265 | CYTH3 | cytohesin 3 | NM_004227.4 | 44.7% | 44.8% | 1_660del;1032T>G |
5 | human | 9266 | CYTH2 | cytohesin 2 | NM_017457.5 | 36.8% | 39.5% | (many diffs) |
6 | human | 9266 | CYTH2 | cytohesin 2 | NM_004228.7 | 36.7% | 39.5% | (many diffs) |
7 | human | 9266 | CYTH2 | cytohesin 2 | XM_006723472.2 | 34.8% | 37.5% | (many diffs) |
8 | human | 9266 | CYTH2 | cytohesin 2 | XM_006723473.2 | 31.7% | 34.2% | (many diffs) |
9 | mouse | 19159 | Cyth3 | cytohesin 3 | NM_001163548.1 | 44.8% | 50.9% | (many diffs) |
10 | mouse | 19159 | Cyth3 | cytohesin 3 | XM_017320729.1 | 44.8% | 50.9% | (many diffs) |
11 | mouse | 19159 | Cyth3 | cytohesin 3 | NM_011182.4 | 39.4% | 44.8% | (many diffs) |
12 | mouse | 19158 | Cyth2 | cytohesin 2 | NM_011181.3 | 36.1% | 39.2% | (many diffs) |
13 | mouse | 19158 | Cyth2 | cytohesin 2 | NM_001112701.1 | 36.1% | 39.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 603
- ORF length:
- 537
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ccgcggcatc aacgagggcg gggacctccc tgaggagctg ctgaggaatt 121 tgtatgagag cattaagaac gagccattta agatcccgga ggacgacggg aacgacctga 181 cccacacctt cttcaacccc gaccgcgagg gctggctcct gaagctggga gggcgtgtga 241 agacctggaa gcgccggtgg ttcatcctga ccgataactg cctctattac tttgaataca 301 caacagataa ggagcccagg ggaatcatcc cgttggaaaa cctcagcatc agggaggtgg 361 aggacccccg gaaacccaac tgttttgagc tctacaatcc cagccacaaa gggcaggtca 421 tcaaggcctg taagacggag gccgacggcc gcgtggtaga ggggaaccat gtggtgtacc 481 ggatctcagc cccgagcccg gaggagaagg aggagtggat gaaatccatc aaagccagta 541 tcagcagaga tcccttctat gacatgttGG CAACGAGGAA ACGAAGGATT GCCAATAAAA 601 AATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 661 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 721 GGCTTTATAT ATCTTGTGGA AAGGACGAAT CGCCCAGGGT ACGTTCCTAG CCACGCGTTA 781 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt