Transcript: Human NM_017482.4

Homo sapiens adducin 2 (ADD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ADD2 (119)
Length:
3766
CDS:
469..2148

Additional Resources:

NCBI RefSeq record:
NM_017482.4
NBCI Gene record:
ADD2 (119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017482.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155732 CCTATCAATGACCTCCACACA pLKO.1 808 CDS 100% 2.640 3.696 N ADD2 n/a
2 TRCN0000155197 GAGTGACACCTATGTCACGTT pLKO.1 924 CDS 100% 0.264 0.370 N ADD2 n/a
3 TRCN0000155731 CCTTACTTTGACCGCTTCTCA pLKO.1 523 CDS 100% 3.000 2.100 N ADD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017482.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05774 pDONR223 100% 75.2% 74.3% None (many diffs) n/a
2 ccsbBroad304_05774 pLX_304 0% 75.2% 74.3% V5 (many diffs) n/a
3 TRCN0000479405 ATTTCCCCGTATGTGTGATTTTGA pLX_317 9.3% 75.2% 74.3% V5 (many diffs) n/a
Download CSV