Transcript: Human NM_017488.4

Homo sapiens adducin 2 (ADD2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ADD2 (119)
Length:
9376
CDS:
469..2400

Additional Resources:

NCBI RefSeq record:
NM_017488.4
NBCI Gene record:
ADD2 (119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017488.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155732 CCTATCAATGACCTCCACACA pLKO.1 808 CDS 100% 2.640 3.696 N ADD2 n/a
2 TRCN0000155197 GAGTGACACCTATGTCACGTT pLKO.1 924 CDS 100% 0.264 0.370 N ADD2 n/a
3 TRCN0000220007 GGGATGGTTTCATCAACATAA pLKO.1 3427 3UTR 100% 13.200 9.240 N ADD2 n/a
4 TRCN0000154857 GCAGAGACAAAGAGCCCTTTA pLKO.1 2379 CDS 100% 10.800 7.560 N ADD2 n/a
5 TRCN0000150818 GAAGGTACTAAGAAGACAGAA pLKO.1 2424 3UTR 100% 4.950 3.465 N ADD2 n/a
6 TRCN0000150743 GAGAGGAAGAAACTAGAACTT pLKO.1 2185 CDS 100% 4.950 3.465 N ADD2 n/a
7 TRCN0000155376 CCCTTTAGTCTCTCCTTCCAA pLKO.1 2393 CDS 100% 3.000 2.100 N ADD2 n/a
8 TRCN0000155731 CCTTACTTTGACCGCTTCTCA pLKO.1 523 CDS 100% 3.000 2.100 N ADD2 n/a
9 TRCN0000155463 GACGAGGATACCAAAGACGAT pLKO.1 2092 CDS 100% 2.640 1.848 N ADD2 n/a
10 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 7119 3UTR 100% 13.200 6.600 Y CLDN18 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7255 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7255 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017488.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05774 pDONR223 100% 81.3% 80.3% None 1315A>G;1740_1825del;1929_1930ins335 n/a
2 ccsbBroad304_05774 pLX_304 0% 81.3% 80.3% V5 1315A>G;1740_1825del;1929_1930ins335 n/a
3 TRCN0000479405 ATTTCCCCGTATGTGTGATTTTGA pLX_317 9.3% 81.3% 80.3% V5 1315A>G;1740_1825del;1929_1930ins335 n/a
Download CSV