Transcript: Human NM_017581.4

Homo sapiens cholinergic receptor nicotinic alpha 9 subunit (CHRNA9), mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
CHRNA9 (55584)
Length:
2272
CDS:
136..1575

Additional Resources:

NCBI RefSeq record:
NM_017581.4
NBCI Gene record:
CHRNA9 (55584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017581.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063393 CCTGATAGGTAAATACTACAT pLKO.1 1026 CDS 100% 4.950 6.930 N CHRNA9 n/a
2 TRCN0000063394 CGAGAGTTACTGTGCACAGTA pLKO.1 1377 CDS 100% 0.495 0.693 N CHRNA9 n/a
3 TRCN0000430165 GATCATAGCAAGAGCGGATTA pLKO_005 1554 CDS 100% 10.800 8.640 N CHRNA9 n/a
4 TRCN0000432794 GGGTGACTGGCCTCTAGTTTA pLKO_005 1821 3UTR 100% 13.200 9.240 N CHRNA9 n/a
5 TRCN0000253090 TTGGTTCCTGGACCTACAATG pLKO_005 653 CDS 100% 10.800 7.560 N Chrna9 n/a
6 TRCN0000063395 CGCTCTCTCAGATTAAGGATA pLKO.1 323 CDS 100% 4.950 3.465 N CHRNA9 n/a
7 TRCN0000063397 GAATGGAAGAAGGTGGCGAAA pLKO.1 1474 CDS 100% 4.050 2.835 N CHRNA9 n/a
8 TRCN0000063396 GCCATGACTGTATTTCAGCTA pLKO.1 967 CDS 100% 2.640 1.848 N CHRNA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017581.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08548 pDONR223 100% 99.9% 99.7% None 1325A>G n/a
2 ccsbBroad304_08548 pLX_304 0% 99.9% 99.7% V5 1325A>G n/a
3 TRCN0000466141 GTACTTAGTCCGCCGTTTAACTCA pLX_317 25.5% 99.9% 99.7% V5 1325A>G n/a
Download CSV