Transcript: Human NM_017686.4

Homo sapiens ganglioside induced differentiation associated protein 2 (GDAP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
GDAP2 (54834)
Length:
8819
CDS:
242..1735

Additional Resources:

NCBI RefSeq record:
NM_017686.4
NBCI Gene record:
GDAP2 (54834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122087 CCTGAACGACAGATTAGAATA pLKO.1 992 CDS 100% 13.200 18.480 N GDAP2 n/a
2 TRCN0000144060 CCGCACATATTAGTACTCTTA pLKO.1 2472 3UTR 100% 4.950 6.930 N GDAP2 n/a
3 TRCN0000142825 CGCACTGTAAGAAGATTCCTA pLKO.1 800 CDS 100% 3.000 4.200 N GDAP2 n/a
4 TRCN0000145253 GAAACGTACTTCAACTAGCAA pLKO.1 690 CDS 100% 3.000 4.200 N GDAP2 n/a
5 TRCN0000121730 CGCACATATTAGTACTCTTAA pLKO.1 2473 3UTR 100% 13.200 9.240 N GDAP2 n/a
6 TRCN0000145488 GATGTCAAGTACAAGAGGAAT pLKO.1 1481 CDS 100% 4.950 3.465 N GDAP2 n/a
7 TRCN0000143694 GCCTTATACCAAACAGGTGTT pLKO.1 1256 CDS 100% 4.050 2.835 N GDAP2 n/a
8 TRCN0000143810 GCTCTATTTGTGCCTTAGCTT pLKO.1 2705 3UTR 100% 3.000 2.100 N GDAP2 n/a
9 TRCN0000142915 CTTGAATATGATGCCAGGGAA pLKO.1 1670 CDS 100% 2.640 1.848 N GDAP2 n/a
10 TRCN0000140851 CCTTGAATATGATGCCAGGGA pLKO.1 1669 CDS 100% 0.660 0.462 N GDAP2 n/a
11 TRCN0000140906 CCTACCTCACAGAGGTATCAT pLKO.1 2755 3UTR 100% 0.563 0.394 N GDAP2 n/a
12 TRCN0000143313 GCTCGAATGGAAGGAGATATT pLKO.1 1103 CDS 100% 13.200 7.920 N GDAP2 n/a
13 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4734 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
14 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4782 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03465 pDONR223 100% 98.1% 97.3% None (many diffs) n/a
2 ccsbBroad304_03465 pLX_304 0% 98.1% 97.3% V5 (many diffs) n/a
3 TRCN0000474118 ACTGGCCACTTGAAGTTTGTTCGA pLX_317 28.5% 98.1% 97.3% V5 (many diffs) n/a
Download CSV