Transcript: Human NM_017770.4

Homo sapiens ELOVL fatty acid elongase 2 (ELOVL2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ELOVL2 (54898)
Length:
3988
CDS:
76..966

Additional Resources:

NCBI RefSeq record:
NM_017770.4
NBCI Gene record:
ELOVL2 (54898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017770.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004965 CGTTAGTCATCCTCTTCTTAA pLKO.1 806 CDS 100% 13.200 18.480 N ELOVL2 n/a
2 TRCN0000314661 TATGTTTGGACCGCGAGATTC pLKO_005 126 CDS 100% 10.800 15.120 N ELOVL2 n/a
3 TRCN0000314664 ATGGCTGGGTAACAAGTATAT pLKO_005 222 CDS 100% 13.200 10.560 N ELOVL2 n/a
4 TRCN0000314660 AGGGTATGTTCTAATCTATAT pLKO_005 1374 3UTR 100% 13.200 9.240 N ELOVL2 n/a
5 TRCN0000314663 GGTGCTTTGGTGGTACTATTT pLKO_005 417 CDS 100% 13.200 9.240 N ELOVL2 n/a
6 TRCN0000314733 ATCTATGCACAAGTATCTTTG pLKO_005 654 CDS 100% 10.800 7.560 N ELOVL2 n/a
7 TRCN0000004966 CACCTTGTATAATCTTGGAAT pLKO.1 279 CDS 100% 4.950 3.465 N ELOVL2 n/a
8 TRCN0000004963 GCTCTCAATATGGCTGGGTAA pLKO.1 213 CDS 100% 4.050 2.835 N ELOVL2 n/a
9 TRCN0000004964 CCACATTCTTATGTACTCCTA pLKO.1 612 CDS 100% 2.640 1.848 N ELOVL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017770.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08428 pDONR223 100% 99.7% 99.6% None 234C>A;646A>G n/a
2 ccsbBroad304_08428 pLX_304 0% 99.7% 99.6% V5 234C>A;646A>G n/a
3 TRCN0000468130 CCCGTAAACACTCCTTGTCTCGAT pLX_317 52.8% 99.7% 99.6% V5 234C>A;646A>G n/a
Download CSV