Transcript: Human NM_017827.4

Homo sapiens seryl-tRNA synthetase 2, mitochondrial (SARS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SARS2 (54938)
Length:
1924
CDS:
28..1584

Additional Resources:

NCBI RefSeq record:
NM_017827.4
NBCI Gene record:
SARS2 (54938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017827.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232586 ATGCCAACCCATCCCAAATTT pLKO_005 857 CDS 100% 15.000 10.500 N SARS2 n/a
2 TRCN0000232588 GTCAGTCACTGACCCTGTTAT pLKO_005 1760 3UTR 100% 13.200 9.240 N SARS2 n/a
3 TRCN0000232585 ACCTGGAAATTGGCGAGAAAC pLKO_005 641 CDS 100% 10.800 7.560 N SARS2 n/a
4 TRCN0000232584 GGAACCTCCTGTACGAGTATG pLKO_005 149 CDS 100% 10.800 7.560 N SARS2 n/a
5 TRCN0000045500 CACCTGGAAATTGGCGAGAAA pLKO.1 640 CDS 100% 4.950 3.465 N SARS2 n/a
6 TRCN0000045499 CCCATCCCAAATTTACAACAT pLKO.1 864 CDS 100% 4.950 3.465 N SARS2 n/a
7 TRCN0000045501 GAGAAGTTTCACTACAGAGAA pLKO.1 120 CDS 100% 4.950 3.465 N SARS2 n/a
8 TRCN0000045502 TGCTTCCAACTGCACAGACTT pLKO.1 1290 CDS 100% 4.950 3.465 N SARS2 n/a
9 TRCN0000045498 CCAACGATAGTCCAAGGAGAA pLKO.1 104 CDS 100% 4.050 2.835 N SARS2 n/a
10 TRCN0000232587 TCACCAAGGTGGAGATGTTTG pLKO_005 1070 CDS 100% 10.800 6.480 N SARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017827.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08432 pDONR223 100% 99.9% 100% None 1344C>T n/a
2 ccsbBroad304_08432 pLX_304 0% 99.9% 100% V5 1344C>T n/a
3 TRCN0000480581 GAAATGCCGATACTTTTCTCATGG pLX_317 19.6% 99.9% 100% V5 1344C>T n/a
Download CSV