Transcript: Human NM_017831.4

Homo sapiens ring finger protein 125 (RNF125), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RNF125 (54941)
Length:
5573
CDS:
40..738

Additional Resources:

NCBI RefSeq record:
NM_017831.4
NBCI Gene record:
RNF125 (54941)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419215 TGGTTAGGCACGATAACTAAT pLKO_005 1083 3UTR 100% 13.200 18.480 N RNF125 n/a
2 TRCN0000004230 CCGTTTAATACCCGATGAGAA pLKO.1 558 CDS 100% 4.950 6.930 N RNF125 n/a
3 TRCN0000004234 GCTCTTGTTCTAATCTCTAAT pLKO.1 1179 3UTR 100% 13.200 10.560 N RNF125 n/a
4 TRCN0000004233 CTGTCCACTTTGCCGTTTAAT pLKO.1 546 CDS 100% 15.000 10.500 N RNF125 n/a
5 TRCN0000418651 AGTGAAATGAGGGCACATATT pLKO_005 367 CDS 100% 13.200 9.240 N RNF125 n/a
6 TRCN0000004232 GCTTGCTGGATCATTGTATTA pLKO.1 494 CDS 100% 13.200 9.240 N RNF125 n/a
7 TRCN0000004231 GAATCACTCGAACACCACATA pLKO.1 717 CDS 100% 4.950 3.465 N RNF125 n/a
8 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 2780 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
9 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 1287 3UTR 100% 4.950 2.475 Y CCDC30 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3708 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 1453 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3315 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2519 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3315 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017831.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467387 TTTAAGAATTCTATTTCCAAAATG pLX_317 66.2% 99.1% 99.5% V5 690_692delCAC;696_697insGCG n/a
2 ccsbBroadEn_14177 pDONR223 99.5% 98.8% 99.1% None (many diffs) n/a
3 ccsbBroad304_14177 pLX_304 0% 98.8% 99.1% V5 (many diffs) n/a
Download CSV