Transcript: Human NM_017848.6

Homo sapiens family with sequence similarity 120C (FAM120C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FAM120C (54954)
Length:
8056
CDS:
57..3347

Additional Resources:

NCBI RefSeq record:
NM_017848.6
NBCI Gene record:
FAM120C (54954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017848.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412858 GGGTCTTATGTACCCATATAT pLKO_005 1907 CDS 100% 15.000 21.000 N FAM120C n/a
2 TRCN0000137106 CCGAGTATGCTCTCTACAATA pLKO.1 841 CDS 100% 13.200 18.480 N FAM120C n/a
3 TRCN0000442962 ACACGCCCAGTATGCTCAATC pLKO_005 2302 CDS 100% 10.800 8.640 N FAM120C n/a
4 TRCN0000138198 CGAAATCAAGTGGGCACCATT pLKO.1 1353 CDS 100% 4.950 3.465 N FAM120C n/a
5 TRCN0000137228 GCGATTCAAGAAAGCAGTTGA pLKO.1 1238 CDS 100% 4.950 3.465 N FAM120C n/a
6 TRCN0000138319 CCCTCTTACTACAGTTCCCAT pLKO.1 864 CDS 100% 2.640 1.848 N FAM120C n/a
7 TRCN0000137646 CCTTAAAGAGTGGTCTGCCTA pLKO.1 2132 CDS 100% 2.640 1.848 N FAM120C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017848.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14179 pDONR223 100% 11.2% 2.4% None (many diffs) n/a
2 ccsbBroad304_14179 pLX_304 0% 11.2% 2.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474860 ACACTCGTGGTCCCACACTGTTTC pLX_317 100% 11.2% 2.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV