Transcript: Human NM_017853.3

Homo sapiens thioredoxin like 4B (TXNL4B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TXNL4B (54957)
Length:
2521
CDS:
292..741

Additional Resources:

NCBI RefSeq record:
NM_017853.3
NBCI Gene record:
TXNL4B (54957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425174 TTGGCTAGTACAACTTGATTT pLKO_005 1054 3UTR 100% 13.200 18.480 N TXNL4B n/a
2 TRCN0000215967 CAAACAAGACTTCATAGATTT pLKO.1 615 CDS 100% 13.200 9.240 N Txnl4b n/a
3 TRCN0000427631 CTAAGACCTCTTCTGACTTAA pLKO_005 428 CDS 100% 13.200 9.240 N TXNL4B n/a
4 TRCN0000422425 GGAAGTAGACCAGGCGATAAA pLKO_005 327 CDS 100% 13.200 9.240 N TXNL4B n/a
5 TRCN0000413434 TTATTGTCCAAAGTCCTATTG pLKO_005 674 CDS 100% 10.800 7.560 N TXNL4B n/a
6 TRCN0000064614 CCAAACAAGACTTCATAGATT pLKO.1 614 CDS 100% 5.625 3.938 N TXNL4B n/a
7 TRCN0000064617 TCTCCAGATCACACTAAGTTT pLKO.1 577 CDS 100% 5.625 3.938 N TXNL4B n/a
8 TRCN0000064616 GACCTTCTCTATCAAGACATT pLKO.1 718 CDS 100% 4.950 3.465 N TXNL4B n/a
9 TRCN0000064613 CCCAAGAATATTCCCAAATAT pLKO.1 697 CDS 100% 1.500 1.050 N TXNL4B n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1169 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03497 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03497 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474876 CCTTCCTAGACCTAGACTTGACTT pLX_317 100% 100% 100% V5 n/a
Download CSV