Transcript: Human NM_018018.5

Homo sapiens solute carrier family 38 member 4 (SLC38A4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC38A4 (55089)
Length:
3983
CDS:
400..2043

Additional Resources:

NCBI RefSeq record:
NM_018018.5
NBCI Gene record:
SLC38A4 (55089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018018.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044712 GCCTATGCAATTCCTATCCTA pLKO.1 1396 CDS 100% 3.000 2.400 N SLC38A4 n/a
2 TRCN0000412437 CTTCAGCTGGATACGACATTT pLKO_005 1740 CDS 100% 13.200 9.240 N SLC38A4 n/a
3 TRCN0000044711 GCAGCAATGAGCAGTCAATTT pLKO.1 505 CDS 100% 13.200 9.240 N SLC38A4 n/a
4 TRCN0000044708 GCTGTGCTTATTGCACTTAAT pLKO.1 1771 CDS 100% 13.200 9.240 N SLC38A4 n/a
5 TRCN0000433992 TGGCAACTACCTCATCATATT pLKO_005 990 CDS 100% 13.200 9.240 N SLC38A4 n/a
6 TRCN0000415810 TTGGAAGCATGGCACTCATTA pLKO_005 1979 CDS 100% 13.200 9.240 N SLC38A4 n/a
7 TRCN0000044710 CCCAATTCGTACATCAGTGAT pLKO.1 1695 CDS 100% 4.950 3.465 N SLC38A4 n/a
8 TRCN0000044709 CGGAACCACTTCCTTTGGAAT pLKO.1 615 CDS 100% 4.950 3.465 N SLC38A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018018.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08467 pDONR223 100% 99.9% 100% None 201T>C n/a
2 ccsbBroad304_08467 pLX_304 0% 99.9% 100% V5 (not translated due to frame shift) 201T>C n/a
3 TRCN0000476589 ATCGAACACGTTAAGGCTATAGCC pLX_317 25.2% 99.9% 100% V5 (not translated due to frame shift) 201T>C n/a
Download CSV