Transcript: Human NM_018074.6

Homo sapiens YJU2 splicing factor homolog (YJU2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
YJU2 (55702)
Length:
1431
CDS:
68..1039

Additional Resources:

NCBI RefSeq record:
NM_018074.6
NBCI Gene record:
YJU2 (55702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018074.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165186 GTGTAAGACGTGCGGAGAATA pLKO.1 193 CDS 100% 13.200 18.480 N YJU2 n/a
2 TRCN0000165296 GTAAGACGTGCGGAGAATACA pLKO.1 195 CDS 100% 5.625 7.875 N YJU2 n/a
3 TRCN0000165395 CCCTTCAACATGAGGTGTAAG pLKO.1 179 CDS 100% 10.800 8.640 N YJU2 n/a
4 TRCN0000165185 GAGCAGCTTCCAACACTACTT pLKO.1 1307 3UTR 100% 4.950 3.960 N YJU2 n/a
5 TRCN0000161525 GAAGAAATTCAATGCTCGGAA pLKO.1 226 CDS 100% 2.640 2.112 N YJU2 n/a
6 TRCN0000165513 GCAGCTTCCAACACTACTTCA pLKO.1 1309 3UTR 100% 4.950 3.465 N YJU2 n/a
7 TRCN0000162914 GTGCGGAGAATACATCTACAA pLKO.1 202 CDS 100% 4.950 3.465 N YJU2 n/a
8 TRCN0000164715 CGGACTTTGACCCATCAAAGA pLKO.1 105 CDS 100% 0.495 0.347 N YJU2 n/a
9 TRCN0000165578 GCAGAGATCACCTTCAAGACA pLKO.1 320 CDS 100% 3.000 1.800 N YJU2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018074.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03633 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03633 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473206 ATGATGACCCCGCCGATGCAGGCC pLX_317 30.7% 100% 100% V5 n/a
Download CSV