Transcript: Human NM_018100.4

Homo sapiens EF-hand domain containing 1 (EFHC1), transcript variant A, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EFHC1 (114327)
Length:
6849
CDS:
70..1992

Additional Resources:

NCBI RefSeq record:
NM_018100.4
NBCI Gene record:
EFHC1 (114327)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053719 CGTCAGGTGAACATTTACTAT pLKO.1 421 CDS 100% 5.625 7.875 N EFHC1 n/a
2 TRCN0000427413 TAACAAGGTGCTTCGTTATTT pLKO_005 1317 CDS 100% 15.000 12.000 N EFHC1 n/a
3 TRCN0000053721 CGAGGAATAAACATCACAATT pLKO.1 577 CDS 100% 13.200 10.560 N EFHC1 n/a
4 TRCN0000425439 GACCAATTCACACAGGTATTT pLKO_005 628 CDS 100% 13.200 9.240 N EFHC1 n/a
5 TRCN0000429844 CCGACATGATCAGTATCTTTG pLKO_005 1406 CDS 100% 10.800 7.560 N EFHC1 n/a
6 TRCN0000053718 CGGTATTACAAAGAGAAGTTT pLKO.1 1126 CDS 100% 5.625 3.938 N EFHC1 n/a
7 TRCN0000053722 CGTGCAGGAATTGGAAGCATT pLKO.1 1734 CDS 100% 4.950 3.465 N EFHC1 n/a
8 TRCN0000053720 GCACGTCCTTTAAGGACTCTA pLKO.1 110 CDS 100% 4.950 3.465 N EFHC1 n/a
9 TRCN0000027711 GCAGGACTAAAGTTGTTAAAT pLKO.1 1472 CDS 100% 15.000 10.500 N Efhc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018100.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09395 pDONR223 100% 99.8% 99.6% None 854G>T;1855A>C n/a
2 ccsbBroad304_09395 pLX_304 0% 99.8% 99.6% V5 854G>T;1855A>C n/a
3 TRCN0000474569 TCTTTACCAACACCGTTTAACCTT pLX_317 15.9% 99.8% 99.6% V5 854G>T;1855A>C n/a
Download CSV