Transcript: Human NM_018178.6

Homo sapiens golgi phosphoprotein 3 like (GOLPH3L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GOLPH3L (55204)
Length:
3124
CDS:
176..1033

Additional Resources:

NCBI RefSeq record:
NM_018178.6
NBCI Gene record:
GOLPH3L (55204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018178.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277670 CCATAGACCTTGACCATTATA pLKO_005 1185 3UTR 100% 15.000 21.000 N GOLPH3L n/a
2 TRCN0000277669 GGATATCCGCCTTACTCTTAT pLKO_005 301 CDS 100% 13.200 18.480 N GOLPH3L n/a
3 TRCN0000277668 TACTAGAGCGGTGGGTAAATG pLKO_005 795 CDS 100% 13.200 18.480 N GOLPH3L n/a
4 TRCN0000156354 CGTATGGACAAGCGAACACTA pLKO.1 824 CDS 100% 4.950 6.930 N GOLPH3L n/a
5 TRCN0000156281 CCGCCTTACTCTTATGGAAGA pLKO.1 307 CDS 100% 4.050 5.670 N GOLPH3L n/a
6 TRCN0000153785 CGACTACTAGACAGAAAGGTA pLKO.1 473 CDS 100% 3.000 4.200 N GOLPH3L n/a
7 TRCN0000152430 CGCAAAGAACCTAGTAGAGAA pLKO.1 664 CDS 100% 4.950 3.960 N GOLPH3L n/a
8 TRCN0000277667 CGCAAAGAACCTAGTAGAGAA pLKO_005 664 CDS 100% 4.950 3.960 N GOLPH3L n/a
9 TRCN0000277671 CTACTCATCCAGTGACCAATA pLKO_005 732 CDS 100% 10.800 7.560 N GOLPH3L n/a
10 TRCN0000153928 CCCAGATTCAATTACCTGGAT pLKO.1 1614 3UTR 100% 2.640 1.848 N GOLPH3L n/a
11 TRCN0000157586 GCAGGAGTACAGTAGTGCAAT pLKO.1 1889 3UTR 100% 4.950 2.970 N GOLPH3L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018178.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08491 pDONR223 100% 99.8% 99.6% None 13A>T n/a
2 ccsbBroad304_08491 pLX_304 0% 99.8% 99.6% V5 13A>T n/a
3 TRCN0000469838 TATTCTACATGCCATGTGTGGCCG pLX_317 22.8% 99.8% 99.6% V5 13A>T n/a
Download CSV