Transcript: Human NM_018180.3

Homo sapiens DEAH-box helicase 32 (putative) (DHX32), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DHX32 (55760)
Length:
3050
CDS:
469..2700

Additional Resources:

NCBI RefSeq record:
NM_018180.3
NBCI Gene record:
DHX32 (55760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240894 AGTGGGTCCTCTTCCATAAAT pLKO_005 2456 CDS 100% 15.000 21.000 N DHX32 n/a
2 TRCN0000240898 GGCGGATGAAATGGATGTTAA pLKO_005 858 CDS 100% 13.200 18.480 N DHX32 n/a
3 TRCN0000240896 CATGACGCGAAGACGGATTTC pLKO_005 2774 3UTR 100% 10.800 8.640 N DHX32 n/a
4 TRCN0000183185 GCCATATTCATCACGTTATTA pLKO.1 606 CDS 100% 15.000 10.500 N DHX32 n/a
5 TRCN0000220044 ATGGATCAGGTAACTACTTAA pLKO.1 2366 CDS 100% 13.200 9.240 N DHX32 n/a
6 TRCN0000240895 CTCTTCTGTCCGGTTACTTTA pLKO_005 2324 CDS 100% 13.200 9.240 N DHX32 n/a
7 TRCN0000240897 GTGTTACTTGGACTTCTTAAA pLKO_005 1054 CDS 100% 13.200 9.240 N DHX32 n/a
8 TRCN0000220043 CTATCAAGGATCTAACCTAAA pLKO.1 1344 CDS 100% 10.800 7.560 N DHX32 n/a
9 TRCN0000180620 GATGGCTGAACTGCTGGATAT pLKO.1 2745 3UTR 100% 10.800 7.560 N DHX32 n/a
10 TRCN0000148220 GAGAACAACTACATCAGGATT pLKO.1 2488 CDS 100% 4.950 3.465 N DHX32 n/a
11 TRCN0000113060 CCTGTGAACAAGATATTGAAA pLKO.1 1307 CDS 100% 5.625 3.938 N Dhx32 n/a
12 TRCN0000113064 GCCTGTGAACAAGATATTGAA pLKO.1 1306 CDS 100% 5.625 3.938 N Dhx32 n/a
13 TRCN0000316981 GCCTGTGAACAAGATATTGAA pLKO_005 1306 CDS 100% 5.625 3.938 N Dhx32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08580 pDONR223 100% 99.9% 100% None 1530A>G n/a
2 ccsbBroad304_08580 pLX_304 0% 99.9% 100% V5 1530A>G n/a
3 TRCN0000472545 TCAGCCACCTGCCGAGTAATGTTG pLX_317 20.8% 99.9% 100% V5 1530A>G n/a
Download CSV