Transcript: Human NM_018182.4

Homo sapiens family with sequence similarity 222 member B (FAM222B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FAM222B (55731)
Length:
4162
CDS:
184..1872

Additional Resources:

NCBI RefSeq record:
NM_018182.4
NBCI Gene record:
FAM222B (55731)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018182.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246352 ACCGTGTCTACCTCAACTATC pLKO_005 910 CDS 100% 10.800 15.120 N Fam222b n/a
2 TRCN0000135562 GTATGCTAAGAAGGTCGCAAA pLKO.1 324 CDS 100% 4.050 5.670 N FAM222B n/a
3 TRCN0000278426 GTATGCTAAGAAGGTCGCAAA pLKO_005 324 CDS 100% 4.050 5.670 N FAM222B n/a
4 TRCN0000135185 CGAATTGGATGCGTATGCTAA pLKO.1 312 CDS 100% 4.950 3.960 N FAM222B n/a
5 TRCN0000278427 CGAATTGGATGCGTATGCTAA pLKO_005 312 CDS 100% 4.950 3.960 N FAM222B n/a
6 TRCN0000194064 GCAAACAACCCACTGACTATA pLKO.1 340 CDS 100% 13.200 9.240 N Fam222b n/a
7 TRCN0000175735 GAAATGGGACACTACACAGAA pLKO.1 261 CDS 100% 4.950 3.465 N Fam222b n/a
8 TRCN0000135485 GACTTCAGAAATGGGACACTA pLKO.1 254 CDS 100% 4.950 3.465 N FAM222B n/a
9 TRCN0000138039 GCCAGAACAGCTTGATGCAAA pLKO.1 1700 CDS 100% 4.950 3.465 N FAM222B n/a
10 TRCN0000297453 GCCAGAACAGCTTGATGCAAA pLKO_005 1700 CDS 100% 4.950 3.465 N FAM222B n/a
11 TRCN0000138920 GTGCACCAGATCAACCAGTTT pLKO.1 988 CDS 100% 4.950 3.465 N FAM222B n/a
12 TRCN0000297452 GTGCACCAGATCAACCAGTTT pLKO_005 988 CDS 100% 4.950 3.465 N FAM222B n/a
13 TRCN0000138699 GCAGTCTGCTCATCAATGCAA pLKO.1 1082 CDS 100% 3.000 2.100 N FAM222B n/a
14 TRCN0000138047 CATTGTCAAAGTGCCAGCCAA pLKO.1 492 CDS 100% 2.640 1.848 N FAM222B n/a
15 TRCN0000278429 CATTGTCAAAGTGCCAGCCAA pLKO_005 492 CDS 100% 2.640 1.848 N FAM222B n/a
16 TRCN0000246353 GTCGCAGTCTGCTCATCAATG pLKO_005 1079 CDS 100% 10.800 6.480 N Fam222b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018182.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03642 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03642 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475611 CCGCGTTTTAGGGAGTACTCTCTA pLX_317 17.2% 100% 100% V5 n/a
Download CSV