Transcript: Human NM_018203.3

Homo sapiens kelch domain containing 8A (KLHDC8A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KLHDC8A (55220)
Length:
2970
CDS:
580..1632

Additional Resources:

NCBI RefSeq record:
NM_018203.3
NBCI Gene record:
KLHDC8A (55220)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137672 GCTGAAGATGGAACGATCGTT pLKO.1 1344 CDS 100% 3.000 4.200 N KLHDC8A n/a
2 TRCN0000137673 GATTACCGAGTATATGCGGCA pLKO.1 955 CDS 100% 0.540 0.756 N KLHDC8A n/a
3 TRCN0000134661 GTTTCCCAACATTCCCTATAA pLKO.1 1191 CDS 100% 13.200 10.560 N KLHDC8A n/a
4 TRCN0000138439 CCTCATCTACTCAGCGAGAAT pLKO.1 2145 3UTR 100% 4.950 3.465 N KLHDC8A n/a
5 TRCN0000135202 CCAACACTATGACATGCTGAA pLKO.1 1014 CDS 100% 4.050 2.835 N KLHDC8A n/a
6 TRCN0000138048 CCAAGAATGTCAGCTCCTGTT pLKO.1 1722 3UTR 100% 4.050 2.835 N KLHDC8A n/a
7 TRCN0000136322 CTATGACATGCTGAAGGACAT pLKO.1 1020 CDS 100% 4.050 2.835 N KLHDC8A n/a
8 TRCN0000135105 CGAGAATTGGACATGAAGCTA pLKO.1 2159 3UTR 100% 3.000 2.100 N KLHDC8A n/a
9 TRCN0000137954 GATGGCTGAAGATGGAACGAT pLKO.1 1340 CDS 100% 3.000 2.100 N KLHDC8A n/a
10 TRCN0000138219 CAAGTGGAAGAAGAGGAGCAT pLKO.1 894 CDS 100% 2.640 1.848 N KLHDC8A n/a
11 TRCN0000138761 GCTGACTCTGAAGAGAGTCTT pLKO.1 1853 3UTR 100% 0.495 0.347 N KLHDC8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08492 pDONR223 100% 99.7% 99.7% None 204C>A;479C>A;717C>A n/a
2 ccsbBroad304_08492 pLX_304 0% 99.7% 99.7% V5 204C>A;479C>A;717C>A n/a
3 TRCN0000467936 CATGCTGGCGGCGACGTATTATGG pLX_317 34.8% 99.7% 99.7% V5 204C>A;479C>A;717C>A n/a
Download CSV